BBa_K252002 1 BBa_K252002 MicF small RNA 2009-10-20T11:00:00Z 2015-05-08T01:11:40Z E. coli MG-1655 Released HQ 2013 MicF is a regulatory sRNA. Its standard coding sequence is a composite with the lac promoter sequence (BBa_R0010). false false _344_ 0 3135 9 In stock false MicF is attached to the lac promoter sequence (BBa_0010). A blunt end of sRNA coding sequence is immediately downstream of the lac promoter sequence. false Graham Heimberg annotation2059543 1 start range2059543 1 173 173 annotation2059540 1 -35 range2059540 1 137 142 annotation2059542 1 LacI binding site range2059542 1 166 200 annotation2059541 1 -10 range2059541 1 161 166 annotation2059537 1 BBa_R0010 range2059537 1 1 200 annotation2059539 1 CAP binding site range2059539 1 89 126 annotation2059538 1 end of LacI coding region (inactive) range2059538 1 1 88 BBa_K252002_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z