BBa_K252006 1 BBa_K252006 MicF small RNA 2009-10-20T11:00:00Z 2015-05-08T01:11:40Z E.Coli-MG-1655 MicF is a regulatory sRNA. Its standard coding sequence is a composite with the Lac Promoter sequence (BBa_R0010). false false _344_ 0 3135 9 It's complicated false Blunt end of sRNA coding sequence is immediately downstream of Lac Promoter sequence (BBa_R0010). false Graham Heimberg BBa_K252006_sequence 1 gctatcatcattaactttatttattaccgtcattcatttctgaatgtctgtttacccctatttcaaccggatgcctcgcattcggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z