BBa_K252009 1 BBa_K252009 OmpF target sequence for MicF 2009-10-20T11:00:00Z 2015-05-08T01:11:40Z E. coli MG-1655 OmpF target sequence is a target sequence complimentary to MicF mall RNA regulator. This OmpF target sequence is followed by a reporter gene GFP. false false _344_ 0 4594 9 It's complicated false OmpF target sequence is fused upstream of the GFP reporter gene. false Steven Waltersdorf BBa_K252009_sequence 1 gaattcgcggccgcttctagatggccggcagggacgatcactgccagaatattgcgcttcatcattatttattaccctcatggttttttttatgacacctgccactgccgtcaataagttctgtcaataaaaatttacggaactattgatgagagtttggtgtctttatgtgtct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z