BBa_K256030 1 BBa_K256030 pluxR:B0034:CHE:B0015 2009-10-18T11:00:00Z 2015-05-08T01:11:41Z -- Intermediate of CHE generator. false false _359_ 0 4864 9 Not in stock false -- false iGEM09_NTU-Singapore component2052803 1 BBa_B0012 component2052801 1 BBa_B0010 component2052800 1 BBa_K256023 component2052794 1 BBa_R0062 component2052799 1 BBa_B0034 annotation2052794 1 BBa_R0062 range2052794 1 1 55 annotation2052799 1 BBa_B0034 range2052799 1 64 75 annotation2052800 1 BBa_K256023 range2052800 1 82 1023 annotation2052803 1 BBa_B0012 range2052803 1 1120 1160 annotation2052801 1 BBa_B0010 range2052801 1 1032 1111 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0062 1 lux pR Promoter (luxR & HSL regulated -- lux pR) 2003-01-31T12:00:00Z 2015-05-08T01:14:15Z <em>V. fischeri</em> Released HQ 2013 Promoter activated by LuxR in concert with HSL</p> <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the LuxR activator protein complexed with the autoinducer, 3-oxo-hexanoyl-HSL. Two molecules of LuxR protein form a complex with two molecules of the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription. false true _1_ 0 24 7 In stock false <P> <P>This promoter is based on the <em>Vibrio fischeri </em>quorum sensing gene promoters. Two genes LuxI and LuxR and transcribed in opposite directions as shown below. The original sequence from which the parts <bb_part>BBa_R0062</bb_part> and <bb_part>BBa_R0063</bb_part> were derived is shown in the picture below. <p><img src="<bb_file>Image1.gif</bb_file>" width="614" height="362"><P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation2045 1 LuxR/HSL range2045 1 1 20 annotation2047 1 -10 range2047 1 42 47 annotation2048 1 start range2048 1 53 53 annotation7070 1 BBa_R0062 range7070 1 1 55 annotation2046 1 -35 range2046 1 20 25 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K256023 1 CHE Cholesteryl Esterase (CHE) 2009-10-16T11:00:00Z 2015-05-08T01:11:41Z -- From Pseudomonas aeruginosa; Code for expression of cholesterol esterase (CHE)which convert cholesteryl ester to free cholesterol false false _359_ 0 4864 9 Not in stock true -- false Zhu Meng annotation2056824 1 misc range2056824 1 1 942 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0062_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaa BBa_K256023_sequence 1 atgaaaaaaaaaagcctgctgccgctgggtctggcaattggtctggcaagcctggcagcatctccgctgattcaggcaagcacctatacccagaccaaatatccgattgttctggcacatggtatgctgggctttgataatattctgggcgtggattattggtttggtattccgagcgcactgcgtcgtgatggtgcacaggtttatgttaccgaagttagccagctggataccagcgaagttcgtggtgaacagctgctgcaacaggttgaagaaattgttgcactgagcggtcagccgaaagttaatctgattggtcatagccatggtggtccgaccattcgttatgttgcagcagttcgtccggatctgattgcaagcgcaaccagcgttggtgcaccgcataaaggtagcgataccgcagattttctgcgtcagattcctccgggtagcgcaggcgaagcaattctgagcggtctggttaatagcctgggtgcactgattagctttctgagcagcggtagcaccggcacccagaatagtctgggttctctggaaagcctgaatagcgaaggtgcagcacgttttaatgcaaaatatccgcagggtgttccgaccagcgcatgtggtgaaggtgcctataaagttaatggcgtgagctattatagctggtctggtagctctccgctgaccaattttctggatccgtctgatgcatttctgggtgcaagcagcctgacctttaaaaatggcaccgcaaatgatggtctggttggcacctgtagcagccatctgggtatggttattcgcgataattaccgcatgaatcatctggatgaagtgaatcaggtttttggtctgaccagcctgtttgaaacctctccggttagcgtttatcgtcagcatgcaaatcgtctgaaaaatgccagcctgtaataataa BBa_B0034_sequence 1 aaagaggagaaa BBa_K256030_sequence 1 acctgtaggatcgtacaggtttacgcaagaaaatggtttgttatagtcgaataaatactagagaaagaggagaaatactagatgaaaaaaaaaagcctgctgccgctgggtctggcaattggtctggcaagcctggcagcatctccgctgattcaggcaagcacctatacccagaccaaatatccgattgttctggcacatggtatgctgggctttgataatattctgggcgtggattattggtttggtattccgagcgcactgcgtcgtgatggtgcacaggtttatgttaccgaagttagccagctggataccagcgaagttcgtggtgaacagctgctgcaacaggttgaagaaattgttgcactgagcggtcagccgaaagttaatctgattggtcatagccatggtggtccgaccattcgttatgttgcagcagttcgtccggatctgattgcaagcgcaaccagcgttggtgcaccgcataaaggtagcgataccgcagattttctgcgtcagattcctccgggtagcgcaggcgaagcaattctgagcggtctggttaatagcctgggtgcactgattagctttctgagcagcggtagcaccggcacccagaatagtctgggttctctggaaagcctgaatagcgaaggtgcagcacgttttaatgcaaaatatccgcagggtgttccgaccagcgcatgtggtgaaggtgcctataaagttaatggcgtgagctattatagctggtctggtagctctccgctgaccaattttctggatccgtctgatgcatttctgggtgcaagcagcctgacctttaaaaatggcaccgcaaatgatggtctggttggcacctgtagcagccatctgggtatggttattcgcgataattaccgcatgaatcatctggatgaagtgaatcaggtttttggtctgaccagcctgtttgaaacctctccggttagcgtttatcgtcagcatgcaaatcgtctgaaaaatgccagcctgtaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z