BBa_K257000 1 Pfec fec promoter (Pfec) - inducible through the Fec transduction pathway (ferric citrate) 2009-06-19T11:00:00Z 2015-05-08T01:11:41Z i just made it up this part is just a try false false _354_ 0 5366 9 It's complicated false this is just a random sequence false Guillaume Cambray annotation2017645 1 -35 range2017645 1 36 41 annotation2017647 1 -10 range2017647 1 57 62 annotation2005937 1 +1 range2005937 1 71 71 annotation2017648 1 important for activity range2017648 1 71 90 BBa_K257000_sequence 1 tacgcggtactggataaacatttcaccactgtaaggaaaataattcttatttcgattgtcctttttacccttctcgttcgactcatagctgaacacaacaaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z