BBa_K257017 1 FecI Fec I, part of the signal transduction pathway FecARI 2009-10-17T11:00:00Z 2015-05-08T01:11:41Z For more information, see: Gene regulation by transmembrane signaling. Volkmar Braun et al., 2006 The fec transduction pathway is unique because it allows a signal to be passed from the extracellular milieu down to the cytoplasm, thus being transmitted through both the outer and inner membrane. Briefly, the outermembrane protein FecA binds ferric citrate, change its conformation to interact with FecR which is an transmembrane protein located in the inner membrane. Then FecR is able to activate FecI an alternative sigma factor specific to Pfec. In some variant of the system, the activated FecR homologues would repress FecI activity instead of activating it. false false _354_ 0 5130 9 It's complicated false Fec I needs to be expressed in association with Fec R behind the Pfec promoter in order to have a functional transduction pathway. false Soufiane Boumahdi annotation2057840 1 fecI range2057840 1 14 532 annotation2057841 1 double codon stop range2057841 1 533 538 annotation2057839 1 good rbs range2057839 1 1 8 BBa_K257017_sequence 1 aaggaggtatataatgtctgaccgcgccactaccacagcttccttaacgttcgagtcgctttatggcacacatcacggctggttgaaaagctggctgacgcgcaaactccagtctgcttttgatgcagatgacattgcccaggacacttttttgcgggtaatggtcagcgaaacgctctcgacgatccgcgatcctcgctccttcctctgcactatcgccaaacgcgtgatggtggacctgtttcgccgaaacgcgctggaaaaagcgtatctggagatgctggcgcttatgccggaggggggagcgccttcacctgaggaacgcgaaagccaactcgagaccctacaactcctcgacagcatgctggacgggctaaacggcaaaacacgtgaagcgtttctgctttcgcaactggatggtctgacatacagcgagattgcgcacaaactcggtgtttccatcagctccgtgaaaaaatacgtggcgaaagccgtcgagcactgcctgctgttccgtctggagtatgggttataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z