BBa_K257020 1 FecR 1-85 FecR 1-85 - amplification of the ferric citrate induction response 2009-10-18T11:00:00Z 2015-05-08T01:11:41Z K12 genomic DNA FecR is a protein that is at the heart of the transduction pathway of the fec operon. But we only need a specific domain. false false _354_ 0 5003 9 It's complicated false We have design oligo in order to have the 85 amino acids of the FecR protein false Romain Bodinier annotation2057972 1 double codon stop range2057972 1 269 274 annotation2057971 1 fecR AA 1-85 range2057971 1 14 268 annotation2057970 1 good rbs range2057970 1 1 8 BBa_K257020_sequence 1 aaggaggtatataatgaatcctttgttaaccgattcccgccgtcaggcgctgcgttcagcttcccactggtatgccgtgctaagcggcgagcgcgtcagcccacaacaggaagcgcgctggcaacagtggtatgaacaggatcaggataaccagtgggcctggcagcaggttgaaaacctgcgcaaccagcttggcggtgtgcctggcgacgttgccagccgggcgttgcacgatacccgcctcacccgccgtcacgtgatgaaaggataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z