BBa_K257024 1 BBa_K257024 Jun : first part of the dimere Jun/Fos 2009-10-29T12:00:00Z 2015-05-08T01:11:42Z DNA Jun is eukaryotic transcription factor that dimerize with fos but can also make homodimere Jun/Jun. We want to adress Jun to the outer membrane and therefore in the vesicle, in order to be accessible for the Fos protein on the membrane of the receiving bacteria. The vesicles could by this mean , the dimere Jun/Fos fuse with the Outer membrane of the receiving bacteria. false false _354_ 0 5003 9 Not in stock false We designed oligo to mutate Jun so it could no more form homodimere false Romain Bodinier annotation2062519 1 jun range2062519 1 1 128 BBa_K257024_sequence 1 tgtggtgggcgtatcgctcgtctggaggaaaaagtgaaaacggacaaagcacagaacagtgagtttgccagtacagccaacatgctgcgtgaacaagttgctcaactgaaacagaaagtcatgaacta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z