BBa_K257025 1 BBa_K257025 Fos : second part of the dimere Jun/Fos 2009-10-29T12:00:00Z 2015-05-08T01:11:42Z DNA Fos is eukaryotic transcription factor that dimerize with Jun We want to adress fos to the outer membrane and therefore be accessible for the Jun protein on the membrane of the vesicles . The vesicles could by this mean , the dimere Jun/Fos, fuse with the Outer membrane of the receiving bacteria. false false _354_ 0 5003 9 Not in stock false nothing particular false Romain Bodinier annotation2062518 1 fos range2062518 1 1 129 BBa_K257025_sequence 1 tgtggtggtctgactgataccctgcaagcagagacagatcaactggaggacgaaaaatcggcactgcaaaccgaaattgccaacctgctgaaagagaaagaaaaactggtctttatcctggcagcctat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z