BBa_K258003 1 BBa_K258003 Granulysin, a T Cell Product,Kills Bacteria by Altering Membrane Permeability 2009-10-02T11:00:00Z 2015-05-08T01:11:42Z Granulysin is a member of the saposin-like protein (SAPLIP) family. Granulysin, a protein located in the acidic granules of human NK cells and cytotoxic T cells, has antimicrobial activity against a broad spectrum of microbial pathogens. Granulysin increased the permeability of bacterial membranes, as judged by its ability to allow access of cytosolic ??-galactosidase to its impermeant substrate. It functions to create holes in the target cell membrane and destroy it. Granulysin is able to induce apoptosis in target cells and also has antimicrobial action. It also alters bacterial membranes by increasing their permeability, inducing lesions on the surface of bacteria and separation of the cell wall and membranes from the cytoplasm. Properties of Granulysin 1. a substance released by cytotoxic T cells (CD8) when attached to infected body cells. 2. create holes in the target cell membrane and destroy it. 3. induce apoptosis in target cells and have antimicrobial action. 4. cytolytic and proinflammatory molecule first identified by subtractive hybridization during a search for genes expressed by human cytotoxic T lymphocytes 3-5 days after their activation. 5. expressed in cytolytic granules with perforin, a pore forming protein, and granzymes involved in cytolysis. 6. broadly antimicrobial, killing microbes that cause, for example, tuberculosis and malaria, and can destroy some tumors. 7. A series of peptides generated from the amino acid sequence of granulysin are potential antibiotics. 8. a member of the saposin-like protein (SAPLIP) family. false true _358_ 0 4260 9 It's complicated false Granulysin was purified via nickel affinity chromatography false Cihan Tastan BBa_K258003_sequence 1 atggcaacatgggctctgctgctgctggctgctatgctgctgggtaatcctggtctggttttctctcgtctgtctcctgagtattatgatctggcccgtgctcacctgcgtgatgaggaaaaatcttgtccttgcctggcacaggaaggtccacagggcgacctgctgacaaaaacacaggaactgggccgtgattatcgtacatgtctgaccgttcagaaactgaaaaaaatggtggataaaccgacacaacgttccgttagcaatgccgctacacgtgtctgtcgtaccggtcgttctcgttggcgtgacgtttgccgtaactttatgcgtcgctatcagtctcgtgttacacaaggcctggttgctggtgaaacagcacaacagtgtgaggatctgcgtctgtgtccatcaactggtcctctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z