BBa_K258004 1 BBa_K258004 Keratinocyte growth factor (KGF) 2009-10-03T11:00:00Z 2015-05-08T01:11:42Z Gene was synthesized at GENEART. Keratinocyte growth factor (KGF) is a locally acting epithelial mitogen that is produced by cells of mesenchymal origin and has an important role in protecting and repairing epithelial tissues.Use of recombinant human KGF (palifermin) in patients with hematologic malignancies reduces the incidence and duration of severe oral mucositis experienced after intensive chemoradiotherapy. These results suggest that KGF may be useful in the treatment of patients with other kinds of tumors, including those of epithelial origin.[1]The potential effect of KGF on wound healing was assessed in vitro by measuring randomized migration and plasminogen activator (PA) activity of keratinocytes in response to the growth factor. Incubation of normal human keratinocytes with KGF in modified MCDB 153 medium significantly stimulated cell migration[2] The Keratinocyte Growth Factor (KGF), also known as FGF7, is a growth factor present in the epithelialization-phase of wound healing. In this phase, keratinocytes are covering the wound, forming the epithelium.[3] . KGF is weakly expressed in human skin, but is strongly upregulated in dermal fibroblasts after skin injury. Its binding to a transmembrane receptor on keratinocytes induces proliferation and migration of these cells. Furthermore, KGF has been shown to protect epithelial cells from the toxic effects of reactive oxygen species. We have identified a series of KGF-regulated genes that are likely to play a role in these processes. In addition to KGF, activin seems to be a novel player in wound healing.[4] false false _358_ 0 4260 9 It's complicated true The gene is in pMA vector having biobrick restriction sites(Ecor1, Xba1 and Spe1,Pst1,respectively) false Ozkan IS BBa_K258004_sequence 1 atgtgtaacgacatgacccctgagcaaatggcaacaaacgtgaactgtagtagtcctgaacgccacactcgctcttatgattatatggagggcggggatattcgtgttcgtcgcctgttctgccgtactcaatggtatctgcgcatcgataaacgtggtaaagtgaaaggcacccaagaaatgaaaaacaactataacatcatggaaatccgtaccgtggcagttggtattgtagcgatcaaaggcgtggaatccgagttctatctggcaatgaacaaagagggcaaactgtatgccaaaaaagagtgtaacgaggactgtaacttcaaagaactgatcctggagaaccattataacacctatgccagcgccaaatggacccataacggtggtgaaatgttcgtggccctgaaccaaaaaggcattccggtccgtggcaaaaaaacgaaaaaagagcagaaaaccgcccacttcctgcctatggccattaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z