BBa_K259002 1 BioScaffol BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker 2009-07-31T11:00:00Z 2015-05-08T01:11:42Z This part was designed ''de novo''. The sequence does not occur naturally. This part is part of a family of Bioscaffold - Linkers. This part will help users interested in protein-fusion. The usage of the part will allow in frame assembly of 2(+) proteins by: *Removing the stop codons from the upstream protein. *Removing the scar created by the Assembly Standard 10 (RFC10) construction of 2(+) protein coding sequences. *Maintaining the start codon of the downstream protein. *Adding a flexible (Gly-Ser-Gly) linker between the two protein coding sequences. *Acting as a translational buffer if ligation is incorrect. ===Assembly Instructions==== *Create an Assembly Standard 10 fusion giving ; **Upstream Protein Part - Bioscaffold Linker - Downstream Protein Part *Use the BioScaffold Specific Enzymes **Restrict with BpuEI to remove upstream scar (created between Upstream Protein - Bioscaffold) and stop codons from upstream protein part. **Ligate and you will get the intermediate product; Upstream Protein (w/out Stop codons) - Tyr - BioScaffold Linker - Downstream Protein **Restrict with BseRI to remove downstream scar. **Ligate to get the final product; Upstream Protein - Tyr-Gly-Ser-Gly- Downstream Protein false false _357_ 0 5318 9 It's complicated false Part was designed taking into account RFC10 assembly standard and as an attempt to be upwards compatible with RFC10. false Petros Mina annotation2014593 1 Met involved in Restriction/Ligation range2014593 1 53 55 annotation2014590 1 BpuEI Site range2014590 1 3 8 annotation2014592 1 Gly-Ser-Gly Linker range2014592 1 44 52 annotation2014595 1 BseRI Site range2014595 1 63 68 annotation2014589 1 Tyr Residue involved in Restriction/Ligation range2014589 1 41 43 annotation2014596 1 BseRI Site range2014596 1 81 86 annotation2014591 1 BpuEI Site range2014591 1 21 26 annotation2014594 1 Translational Buffer range2014594 1 56 62 BBa_K259002_sequence 1 atctcaagagtggcagcggtcttgagtggcagcggcggtatacggcagcggtatgtaactagctcctcagtggcagcggtgaggaggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z