BBa_K259004 1 BioScaffol BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker 2009-07-31T11:00:00Z 2015-05-08T01:11:42Z This part is completely designed ''de novo''. This sequence does not occur naturally. This part is part of a family of Bioscaffold - Linkers. This part will help users interested in protein-fusion. The usage of the part will allow in frame assembly of 2(+) proteins by: *Removing the stop codons from the upstream protein. *Removing the scar created by the Assembly Standard 10 (RFC10) construction of 2(+) protein coding sequences. *Maintaining the start codon of the downstream protein. *Adding a flexible (Gly-Ser-Gly) linker between the two protein coding sequences. *Acting as a translational buffer if ligation is incorrect. ===Assembly Instructions=== *Create an Assembly Standard 10 fusion as below ; **Upstream Protein Part - Bioscaffold Linker - Downstream Protein Part** [[Image:BCCS_Assembly_of_Scaffold.jpg|thumb|500px|center|The Product of Assembly between 2 proteins and the Bioscaffold Linker. ]] *Use the BioScaffold Specific Enzymes (i)Restrict with BpuEI to remove upstream scar (created between Upstream Protein - Bioscaffold) and stop codons from upstream protein part.<br/> (ii)Ligate and you will get the intermediate product; **Upstream Protein (w/out Stop codons) - Tyr - BioScaffold Linker - Downstream Protein** *Restrict with CspCI to remove downstream scar. *Ligate to get the final product; **Upstream Protein - Tyr-Gly-Ser-Gly- Downstream Protein** [[Image:BCCS_Bioscaffold_Reaction_Explanation_CspCI.jpg|thumb|500px|center|The Reaction and the product. ]] false false _357_ 0 5318 9 It's complicated false This part was designed taking into consideration the requirements by Assembly Standard 10 (RFC10). false Petros Mina annotation2014597 1 BpuEI range2014597 1 3 8 annotation2014603 1 CspCI (5' Recognition Seq) range2014603 1 66 68 annotation2014602 1 Translational Buffer range2014602 1 56 65 annotation2014604 1 Translational Buffer range2014604 1 70 72 annotation2014600 1 Gly-Ser-Gly Linker range2014600 1 44 52 annotation2014599 1 Tyr Involved in Restriction/Ligation range2014599 1 41 43 annotation2014601 1 Met Involved in Restriction/Ligation range2014601 1 53 55 annotation2014605 1 CspCI (3' Recognition Seq) range2014605 1 74 77 annotation2014598 1 BpuEI range2014598 1 21 26 BBa_K259004_sequence 1 atctcaagagtggcagcggtcttgagtggcagcggcggtatacggcagcggtatgtaagtagtaacaagtagcgtggggca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z