BBa_K259008 1 BBa_K259008 BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker 2009-10-12T11:00:00Z 2015-05-08T01:11:42Z This part is completely designed de novo. This sequence does not occur naturally. This part is part of a family of Bioscaffold - Linkers. This part will help users interested in protein-fusion. The usage of the part will allow in frame assembly of 2(+) proteins by: *Removing the stop codons from the upstream protein. *Removing the scar created by the Assembly Standard 10 (RFC10) construction of 2(+) protein coding sequences. *Maintaining the start codon of the downstream protein. *Adding a flexible (Gly-Ser-Gly) linker between the two protein coding sequences. *Acting as a translational buffer if ligation is incorrect. ===Assembly Instructions=== *Create an Assembly Standard 10 fusion as below ; **Upstream Protein Part - Bioscaffold Linker - Downstream Protein Part** [[Image:BCCS_Assembly_of_Scaffold.jpg|thumb|500px|center|The Product of Assembly between 2 proteins and the Bioscaffold Linker. ]] *Use the BioScaffold Specific Enzymes (i)Restrict with BpuEI to remove upstream scar (created between Upstream Protein - Bioscaffold) and stop codons from upstream protein part.<br/> (ii)Ligate and you will get the intermediate product; **Upstream Protein (w/out Stop codons) - Tyr - BioScaffold Linker - Downstream Protein** *Restrict with CspCI to remove downstream scar. *Ligate to get the final product; **Upstream Protein - Tyr-Gly-Ser-Gly- Downstream Protein** [[Image:BCCS_Bioscaffold_Reaction_Explanation_CspCI.jpg|thumb|500px|center|The Reaction and the product. ]] ====N.B.==== CspCI cuts with a 1 b.p discrepancy depending on the sequence. However this should not affect the restriction/ligation process as this has been taken into account and incorporated into the design. Even with the discrepancy involved the restriction/ligation process will still give the same product and in-frame fusion. The other restriction variants of CspCI have also been taken into account and relevant BioScaffolds are being produced to be tested. Updates will soon follow on this. This version accounts for cleaving DNA 12/10bp (top/bottom) on the 5' of the recognition sequence and 10/12bp (top/bottom) on the 3' site. false false _357_ 0 5318 9 It's complicated false CspCI enzyme has different variations in the distance of restricting DNA from the recognition site.This biobrick is almost identical to part BBa_K259004 but modified to account for this discrepancy. false Petros Mina annotation2037353 1 Gly-Ser-Gly Linker range2037353 1 44 52 annotation2037356 1 5' CspCI recognition site range2037356 1 65 67 annotation2037357 1 3' CspCI Recognition site range2037357 1 73 76 annotation2037358 1 Translational buffer range2037358 1 68 72 annotation2037351 1 Tyr involved in Restriction/Ligation range2037351 1 41 43 annotation2037354 1 Met involved in Restriction/Ligation range2037354 1 53 55 annotation2037350 1 BpuEI (rev.comp) range2037350 1 3 8 annotation2037355 1 Translational Buffer range2037355 1 56 64 annotation2037352 1 BpuEI range2037352 1 21 26 BBa_K259008_sequence 1 atctcaagagtggcagcggtcttgagtggcagcggcggtatacggcagcggtatgtaagtagtacaagtagcgtggggc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z