BBa_K259009 1 BBa_K259009 BioScaffold Linker - Removes Stop Codons & scars & replaces with a Gly-Ser linker 2009-10-12T11:00:00Z 2015-05-08T01:11:42Z This part is completely designed ''de novo''. This sequence does not occur naturally. This part is part of a family of Bioscaffold - Linkers. This part will help users interested in protein-fusion. The usage of the part will allow in frame assembly of 2(+) proteins by: *Removing the stop codons from the upstream protein. *Removing the scar created by the Assembly Standard 10 (RFC10) construction of 2(+) protein coding sequences. *Maintaining the start codon of the downstream protein. *Adding a flexible (Gly-Ser-Gly) linker between the two protein coding sequences. *Acting as a translational buffer if ligation is incorrect. ===Assembly Instructions=== *Create an Assembly Standard 10 fusion as below ; **Upstream Protein Part - Bioscaffold Linker - Downstream Protein Part** [[Image:BCCS_Assembly_of_Scaffold.jpg|thumb|500px|center|The Product of Assembly between 2 proteins and the Bioscaffold Linker. ]] *Use the BioScaffold Specific Enzymes (i)Restrict with BpuEI to remove upstream scar (created between Upstream Protein - Bioscaffold) and stop codons from upstream protein part.<br/> (ii)Ligate and you will get the intermediate product; **Upstream Protein (w/out Stop codons) - Tyr - BioScaffold Linker - Downstream Protein** *Restrict with CspCI to remove downstream scar. *Ligate to get the final product; **Upstream Protein - Tyr-Gly-Ser-Gly- Downstream Protein** [[Image:BCCS_Bioscaffold_Reaction_Explanation_CspCI.jpg|thumb|500px|center|The Reaction and the product. ]] ====N.B.==== CspCI cuts with a 1 b.p discrepancy depending on the sequence. However this should not affect the restriction/ligation process as this has been taken into account and incorporated into the design. Even with the discrepancy involved the restriction/ligation process will still give the same product and in-frame fusion. The other restriction variants of CspCI have also been taken into account and relevant BioScaffolds are being produced to be tested. This version is for when CspCI cuts 13/10b.p. (top/bottom) on the 5' of the recognition sequence and 10/13bp (top/bottom) on the 3' of the recognition sequence. false false _357_ 0 5318 9 It's complicated false The CspCI discrepancy had to be taken into account false Petros Mina annotation2037403 1 Gly-Ser-Gly linker range2037403 1 44 52 annotation2037400 1 BpuEI (rev. complement) range2037400 1 3 8 annotation2037437 1 5' CspCI Recognition sequence range2037437 1 66 68 annotation2037402 1 Tyr involved in restriction/ligation range2037402 1 41 43 annotation2037405 1 Translational Buffer range2037405 1 56 65 annotation2037439 1 Translational Buffer range2037439 1 69 73 annotation2037404 1 Met involved in restriction/ligation range2037404 1 53 55 annotation2037438 1 3' CspCI recognition sequence range2037438 1 74 77 annotation2037401 1 BpuEI range2037401 1 21 26 BBa_K259009_sequence 1 atctcaagagtggcagcggtcttgagtggcagcggcggtatacggcagcggtatgtaagtagtaacaagtagcgtggggcag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z