BBa_K259011 1 BBa_K259011 OsmE-Outer Membrane Protein in E.coli 2009-10-14T11:00:00Z 2015-05-08T01:11:42Z This part occurs naturally in the E.coli genome at 39.27 minutes in the counterclockwise direction. [http://ecogene.org/geneinfo.php?eg_id=EG10044 | EG10044 EcoGENE accession number] This is an Outer Membrane monomeric protein in E.coli. It is an osmotically inducible lipoprotein, not toxic but it's usage is unknown. false false _357_ 0 5318 9 It's complicated false This part carries an unmutated EcoRI site. false Petros Mina BBa_K259011_sequence 1 atgaacaagaatatggcaggaattctgagtgcagcggcggtattaaccatgctggcgggttgtacggcttatgatcgtaccaaagaccagtttgtacagcctgtggtgaaagacgtcaaaaaaggcatgagccgggcgcaggttgcacaaattgcgggtaaaccttcgtctgaagtgagcatgatccatgctcgcggtacttgccagacctacatcctgggtcaacgtgatggtaaagcagaaacctactttgtcgcgttagatgataccggacatgtcatcaactccggttatcagacctgtgctgaatacgacactgatccacaggctgcgaagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z