BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_J61100 1 BBa_J61100 Ribosome Binding Site Family Member 2007-01-28T12:00:00Z 2015-08-31T02:03:00Z N/A {{JCA_Arkin_RBSFamily}} false true _95_ 0 483 95 In stock false N/A true John Anderson BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_R0081 1 AraC O2 Inhibitor (AraC loop attachment with O2 site) 2004-01-29T12:00:00Z 2015-05-08T01:14:15Z Released HQ 2013 this piece of DNA contains a "dead" part of coding region for AraC, and a functional Operator2 site. when attached to the rest of the promoter region, this part allows for the binding and loop formation that would result in repression of the araC promoter false false _1_ 0 24 7 In stock false 1) changed ATG start codon to TAG stop 2) 6 random deletions upstream of putative araC binding sites to preserve spacing for loop back (BB ends will add 6 base pairs); spacing crucial in matching up O2 and I2 binding sites (turns of DNA helix) 3) designed to attach to R0080 to enable all (positive and negative) regulatory functions, and to form "loop back" true Sara Neves (Fighting Darwins) annotation331786 1 stem_loop range331786 1 22 37 annotation331785 1 defunct araC range331785 1 1 78 annotation331787 1 stem_loop range331787 1 57 72 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_K259013 1 BBa_K259013 AraC-RBS-GFP-Terminator 2009-10-14T11:00:00Z 2015-05-08T01:11:42Z This part was designed with the specified biobricks from the parts registry. AraC occurs naturally in E.coli. GFP occurs in jellyfish species, RBS designed by the Anderson family and Terminator by Resma Shetty. A part used to quantify the AraC-RBS construct <partinfo>K259007</partinfo> created by the BCCS-Bristol iGEM'09 team. false false _357_ 0 5318 9 It's complicated false RFC10 assembly false Petros Mina component2041451 1 BBa_B0011 component2041444 1 BBa_J61100 component2041443 1 BBa_R0080 component2041436 1 BBa_R0081 component2041446 1 BBa_E0040 component2041447 1 BBa_B0012 annotation2041451 1 BBa_B0011 range2041451 1 1144 1189 annotation2041446 1 BBa_E0040 range2041446 1 367 1086 annotation2041444 1 BBa_J61100 range2041444 1 349 360 annotation2041443 1 BBa_R0080 range2041443 1 192 340 annotation2041436 1 BBa_R0081 range2041436 1 1 183 annotation2041447 1 BBa_B0012 range2041447 1 1095 1135 BBa_R0080 1 AraC Promoter (AraC regulated) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z GenBank: J01641 (www.ncbi.nlm.nih.gov) Released HQ 2013 AraC operator, truncated to include araO1, araI1, araI2, c-amp1, and c-amp2 sites. This operator should *activate* transcription in the presence of AraC; b/c the operator lacks the araO2 site, there should not be araC-mediated repression. false false _1_ 0 24 7 In stock false true Sara Neves (Fighting Darwins) annotation301457 1 araO1 range301457 1 6 44 annotation301456 1 c-amp2 range301456 1 4 29 annotation308601 1 -35 range308601 1 113 118 annotation301458 1 c-amp1 range301458 1 43 72 annotation301462 1 ara1 and ara2 range301462 1 73 101 annotation308602 1 -10 range308602 1 136 141 BBa_J61100_sequence 1 aaagaggggaca BBa_K259013_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaactactagaggcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccattactagagaaagaggggacatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_R0081_sequence 1 caggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgctacagacattgccgtcactggtctttactggctcttctcgctaaccaaaccggtaaccgcttattaaagcattctgtaacaaagcgggaccaaagccatgacaaaac BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0080_sequence 1 gcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z