BBa_K260015 1 BBa_K260015 P_FRT_dhfr. (strong promoter, translated FRT site, trimethoprim resistance) 2009-10-17T11:00:00Z 2015-05-08T01:11:42Z This part was synthesised by "Mr Gene" (Geneart) and is available in the following plasmid backbones: [[Part:BBa_K260004|]]: pMA-@CC2FosMB-00500bp [[Part:BBa_K260005|]]: pMA-@CC2FosMB-01000bp [[Part:BBa_K260006|]]: pMA-@CC2FosMB-02000bp [[Part:BBa_K260007|]]: pMA-@CC2FosMB-05000bp [[Part:BBa_K260008|]]: pMA-RQ-@CC2FosMB-10000bp This is the first of two parts of a FLP recombinase reporter. It has a strong promoter, a translated FRT site, and a codon-optimised gene for trimethoprim resistance (TmpR) called dhfr. The second part of this FLP recombinase reporter is the TT_FRT_GFP BioBrick ([[Part:BBa_K260016|]]). They can both be transferred to the pCC2FosM ([[Part:BBa_K260000|]]) and pCC2FosMB ([[Part:BBa_K260001|]]) backbones, at defined loci to vary the distance between both FRT sites, of which each part has exactly one. The position of the TT_FRT_GFP BioBrick ([[Part:BBa_K260016|]]) is always the same, whereas the position of P_FRT_dhfr ([[Part:BBa_K260015|]]) can be varied to give inter-FRT distances of 500 bp, 1 kb, 2 kb, 5 kb, 10 kb. This is achieved by starting with different backbones to contain the present BioBrick part ([[Part:BBa_K260015|]]), that have specific homology arms for recombineering-mediated transfer of P_FRT_dhfr to defined positions: [[Part:BBa_K260004|]]: pMA-@CC2FosMB-00500bp [[Part:BBa_K260005|]]: pMA-@CC2FosMB-01000bp [[Part:BBa_K260006|]]: pMA-@CC2FosMB-02000bp [[Part:BBa_K260007|]]: pMA-@CC2FosMB-05000bp [[Part:BBa_K260008|]]: pMA-RQ-@CC2FosMB-10000bp See [[Part:BBa_K260016|]] for how this reporter works. false false _356_ 0 1072 57 It's complicated true A strong promoter was necessary and we use [[Part:BBa_J23100|]]. An appropriate reading frame for the FRT site had to be found to prevent premature Stop-codons and hydrophobic amino acid residues. Further, the gene encoding TmpR was codon-optimised. false Kaj Bernhardt annotation2051362 1 translated FRT site range2051362 1 66 99 annotation2051361 1 ATG_Start range2051361 1 62 64 annotation2051345 1 BBa_B0034 (Elowitz RBS) range2051345 1 44 55 annotation2051363 1 optimised TmpR range2051363 1 101 334 annotation2051344 1 BBa_J23100 (strong promoter) range2051344 1 1 35 BBa_K260015_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgggaagttcctattctctagaaagtataggaacttctggtcagtcttccgacgaagcgaacgctccggttgctggccagtttgcgctgccgctgtctgcaacctttggcctgggcgatcgcgtacgcaagaaatctggtgccgcttggcagggtcaagttgtgggttggtattgcaccaaactgactccagaaggctatgcggttgagtccgaatcccacccaggctctgtgcaaatttatccagtggctgcactggaacgtgtggcctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z