BBa_K260016 1 BBa_K260016 TT_FRT_GFP. (double terminator, FRT site, optimised GFP) 2009-10-17T11:00:00Z 2015-05-08T01:11:42Z This part was synthesised by "Mr Gene" (Geneart) and is available in the original pMA-BsdR-@CC2FosMB plasmid backbone ([[Part:BBa_K260010|]]), but also pCC2FosMB [[Part:BBa_K260001|]], which is already half-way towards constructing the full P_FRT_dhfr_TT_FRT_GFP reporter. This is the second of two parts of a FLP recombinase reporter. It has a double terminator, a translatable FRT site, and a codon-optimised GFP identical in amino acid sequence to [[Part:BBa_E0040|]]. The first part of this FLP recombinase reporter is the P_FRT_dhfr BioBrick ([[Part:BBa_K260015|BBa_K260015]]). They can both be transferred to the pCC2FosM ([[Part:BBa_K260000|BBa_K260000]]) and pCC2FosMB ([[Part:BBa_K260001|BBa_K260001]]) backbones, at defined loci to vary the distance between both FRT sites, of which each part has exactly one. The position of this TT_FRT_GFP BioBrick ([[Part:BBa_K260016|BBa_K260016]]) is always the same, whereas the position of P_FRT_dhfr ([[Part:BBa_K260015|BBa_K260015]]) can be varied to give inter-FRT distances of 500 bp, 1 kb, 2 kb, 5 kb, 10 kb. This is achieved by starting with different backbones to contain the present BioBrick part ([[Part:BBa_K260015|BBa_K260015]]), that have specific homology arms for recombineering-mediated transfer of P_FRT_dhfr to defined positions: [[Part:BBa_K260004|BBa_K260004]]: pMA-@CC2FosMB-00500bp [[Part:BBa_K260005|BBa_K260005]]: pMA-@CC2FosMB-01000bp [[Part:BBa_K260006|BBa_K260006]]: pMA-@CC2FosMB-02000bp [[Part:BBa_K260007|BBa_K260007]]: pMA-@CC2FosMB-05000bp [[Part:BBa_K260008|BBa_K260008]]: pMA-RQ-@CC2FosMB-10000bp '''This is how the full reporter works:''' P_FRT_dhfr_(intervening sequence)_TT_FRT-GFP The genes for GFP (mut3b) and TmpR (dhfr) have no Start-codon and GFP is silenced by the upstream terminator, but TmpR is expressed. If FLP recombinase levels are high enough, recombination between both FRT sites will delete the intervening dhfr gene plus terminator. Now GFP replaces dhfr and comes under the control of the constitutive promoter that was driving expression of an FRT-TmpR fusion protein before. The result is an FRT-GFP fusion protein that turns the cell green. This reporter is essentially a FLP activity measurement device, where the transfer curve of [FLP]->GFP can be varied by length of the intervening sequence and thus the distance between both FRT sites. It is similar to P_F3_ZeoR_F3_RFP [[Part:BBa_K260017|]], which is also a FLP recombinase reporter. false false _356_ 0 1072 57 It's complicated true A strong promoter was necessary and we use [[Part:BBa_J23100|BBa_J23100]]. An appropriate reading frame for the FRT site had to be found to prevent premature Stop-codons and hydrophobic amino acid residues. Further, the gene encoding GFP (mut3b) was codon optimised for expression in both E. coli and H. sapiens. For potential use in H. sapiens, the CDS were also made free of polyA sites, exon junctions and CpG dinucleotides where possible. false Kaj Bernhardt annotation2051388 1 BBa_B0015 (double terminator) range2051388 1 1 129 annotation2051391 1 BBa_K260016 range2051391 1 1 882 annotation2051389 1 translated FRT site range2051389 1 131 164 annotation2051390 1 optimised GFP (mutb3) range2051390 1 166 882 BBa_K260016_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatgaagttcctattctctagaaagtataggaacttctgcaagcaaaggtgaagaactgttcactggtgttgtcccaattctggttgagctggatggtgatgtgaatggccacaaattttctgtgtctggtgaaggtgagggtgatgcaacttatggcaaactgactctgaaatttatctgtaccactggcaaactgcctgttccatggccaactctggtcaccactttctcttatggtgtgcagtgttttgcaagatacccagatcacatgaaacagcatgacttcttcaaatctgccatgcctgaaggctatgtccaagaaagaaccatctctttcaaggatgatggtaactataaaaccagagctgaagttaaatttgagggtgacaccctggtgaacagaattgaactgaaaggcattgacttcaaagaggatggcaacattctgggtcacaagctggaatacaactataactcccacaatgtttacattactgctgacaagcagaagaatggcatcaaagcaaacttcaagatcagacacaacattgaagatggtggtgtacaactggcagatcactatcagcagaacactcctattggtgatggcccagtactgctgccagataaccattacctgtccacccagagcaaactgtctaaagacccaaatgaaaagagagaccacatggtactgctggaatttgttactgctgctggcattacccatggtatggatgaactgtataaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z