BBa_K260017 1 BBa_K260017 P_F3_ZeoR_F3_RFP. [FLP]->RFP 2009-10-16T11:00:00Z 2015-05-08T01:11:42Z This part was synthesised by "Mr Gene" (Geneart) and is available in the following plasmid backbones: pMA-RQ-@TetFlp (BBa_K260009) pTetFlp (BBa_K260002) pRhaFlp (BBa_K260003) This is a FLP recombinase reporter. The gene for RFP (mRFP1) has no Start-codon and is silenced by the upstream terminator. If FLP recombinase levels are high enough, recombination between both F3 sites will delete the intervening ZeoR gene plus terminator. Now RFP comes under the control of the constitutive promoter that was driving expression of an F3-ZeoR fusion protein before. The result is an F3-RFP fusion protein that turns the cell red. Since this part is available in plasmid backbones pTetFlp (BBa_K260002) and pRhaFlp (BBa_K260003), FLP expression and thus RFP fluorescence can be controlled by small molecules (anhydrotetracycline and L-rhamnose respectively). It is thus a PoPS measurement device, where tet- and rhamnose- promoters can be compared and FLP activity be titrated. false false _356_ 0 1072 57 It's complicated true A strong promoter was necessary and we use BBa_J23100. An appropriate reading frame for the F3 sites had to be found to prevent premature Stop-codons and hydrophobic amino acid residues. Further, the genes encoding ZeoR and mRFP1 were codon optimised for expression in both E. coli and H. sapiens. For potential use in H. sapiens, the CDS were also made free of polyA sites, exon junctions and CpG dinucleotides where possible. The leading alanine of ZeoR was omitted to have exactly 500 bp between both F3 sites. false Kaj Bernhardt annotation2048734 1 BBa_J23100 (strong promoter) range2048734 1 1 35 annotation2048739 1 BBa_B0015 (double terminator) range2048739 1 470 598 annotation2048741 1 optimised mRFP1 (without Start-codon) range2048741 1 635 1309 annotation2048736 1 ATG-Start range2048736 1 62 64 annotation2048740 1 F3 site range2048740 1 600 633 annotation2048738 1 optimised ZeoR range2048738 1 101 469 annotation2048735 1 BBa_B0034 (Elowitz RBS) range2048735 1 44 55 annotation2048737 1 translated F3 site range2048737 1 66 99 BBa_K260017_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaatactagatgggaagttcctattcttcaaatagtataggaacttctaagctgacctctgctgttccagtgctgactgctagagatgtggcaggtgctgttgagttctggactgacagactgggcttctccagagactttgtggaggatgactttgcaggtgtggttagagatgatgtgaccctgttcatctctgctgtccaggaccaggtggtgccagacaacaccctggcctgggtgtgggtgagaggcctggatgagctgtatgctgagtggtctgaggttgtgtccactaacttcagagatgcctctggcccagccatgactgagattggtgagcagccttggggcagagagtttgccctgagagacccagcaggcaactgtgtgcactttgtggctgaggagcaggactgaccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatgaagttcctattcttcaaatagtataggaacttctgcctcctctgaggatgtcatcaaggagttcatgagattcaaagttagaatggagggttctgttaatggtcatgagtttgagattgaaggtgaaggtgagggcagaccatatgaaggcacccagactgccaaactgaaagtgactaagggtggccctctgccatttgcttgggacatcctgagccctcaatttcagtatggttctaaagcatatgttaaacaccctgctgatatccctgactatctgaagctgtcttttcctgaaggcttcaagtgggaaagagtcatgaattttgaagatggtggtgtggtcactgtcacccaggacagctccctgcaagatggtgagttcatctataaagttaaactgagaggtactaattttccatctgatggccctgtgatgcagaagaagaccatgggttgggaggccagcactgaaagaatgtatcctgaagatggtgccctgaaaggtgaaatcaaaatgagactgaaactgaaagatggtggccattatgatgctgaagtgaaaaccacttatatggccaagaaacctgtgcaactgcctggtgcttacaaaactgatatcaaactggacatcacctctcataatgaagattataccattgtggagcaatatgagagagctgagggcagacatagcactggtgcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z