BBa_K264008 1 BBa_K264008 K264001.scar.J23101 (UP/promoter) 2009-10-19T11:00:00Z 2015-05-08T01:11:42Z Combination of pre-existing biobrick parts. This promoter is a combination of the up element BBa_K264001 and constitutive promoter BBa_J23101. false false _364_ 0 5051 9 Not in stock false During design spacing between the up element and promoter had to be considered. false Kevin Bussing component2056321 1 BBa_J23101 component2056320 1 BBa_K264001 annotation2056320 1 BBa_K264001 range2056320 1 1 24 annotation2056321 1 BBa_J23101 range2056321 1 33 67 BBa_K264001 1 BBa_K264001 Modular UP-element Design 2 2009-10-18T11:00:00Z 2015-05-08T01:11:42Z Rational redesign of BBa_K264000 The UP element is a component of the promoter located upstream of the -35 region. Though not necessary for transcription, the UP element increases the rate of transcription initiation by interacting with the alpha-subunit of RNA polymerase. A consensus sequence, -59 nnAAA(A/T)(A/T)T(A/T)TTTTnnAAAAnnn -38, was derived from a collection of many UP elements based on nucleotide frequency at each position (Estrem et al., 1998). UP Element Design 1 is the UP element with the highest transcription rate increase reported in that study. Design 1 was systematically modified (BBa_K264001-K264007) to vary the relative strength of its effect based on the hypothesis that the most significant promoter enhancement would occur when the UP element sequence used the most frequently-occurring nucleotides at each position (i.e., the consensus sequence). A spacer, CT, is placed between the UP element and subsequent promoters to maintain proper alignment with RNAP. false false _364_ 0 5271 9 Not in stock false The observed UP elements were A-T rich. Therefore, the rational sequence modifications of Design 1 were made to preserve this feature. Nucleotides in Design 1 at positions -59, -58, -54, and -45 were changed from G to T, G to A, A to T, and C to G, respectively. A spacer, CT, is placed between the UP element and subsequent promoters to maintain proper alignment with RNAP. false Adam Bower BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K264008_sequence 1 taaaatttttttttgaaaagtacttactagagtttacagctagctcagtcctaggtattatgctagc BBa_K264001_sequence 1 taaaatttttttttgaaaagtact BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z