BBa_K264049 1 BBa_K264049 K264003.J23119 (UP/promoter) 2009-11-10T12:00:00Z 2015-05-08T01:11:43Z This is a composite part. This engineered part is a combination of UP element BBa_K264003 and constitutive promoter BBa_J23119. false false _364_ 0 2920 9 Not in stock false A spacer, CT, was placed at the end of the UP element to serve as a 2 bp spacer between the UP-element and promoter. There is no scar between the UP element and promoter. false George McArthur IV component2062621 1 BBa_J23119 component2062620 1 BBa_K264003 annotation2062621 1 BBa_J23119 range2062621 1 25 59 annotation2062620 1 BBa_K264003 range2062620 1 1 24 BBa_K264003 1 BBa_K264003 Modular UP-element Design 4 2009-10-18T11:00:00Z 2015-05-08T01:11:42Z Rational redesign of BBa_K264000 The UP element is a component of the promoter located upstream of the -35 region. Though not necessary for transcription, the UP element increases the rate of transcription initiation by interacting with the alpha-subunit of RNA polymerase. A consensus sequence, -59 nnAAA(A/T)(A/T)T(A/T)TTTTnnAAAAnnn -38, was derived from a collection of many UP elements based on nucleotide frequency at each position (Estrem et al., 1998). UP Element Design 1 is the UP element with the highest transcription rate increase reported in that study. Design 1 was systematically modified (BBa_K264001-K264007) to vary the relative strength of its effect based on the hypothesis that the most significant promoter enhancement would occur when the UP element sequence used the most frequently-occurring nucleotides at each position (i.e., the consensus sequence). A spacer, CT, is placed between the UP element and subsequent promoters to maintain proper alignment with RNAP. false false _364_ 0 5271 9 Not in stock false The observed UP elements were A-T rich. Therefore, the rational sequence modifications of Design 1 were made to preserve this feature. Nucleotides in Design 1 at positions -59, -58, -54, and -45 were changed from G to A, G to A, A to T, and C to G, respectively. A spacer, CT, is placed between the UP element and subsequent promoters to maintain proper alignment with RNAP. false Adam Bower BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_K264003_sequence 1 aaaaatttttttttgaaaagtact BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_K264049_sequence 1 aaaaatttttttttgaaaagtactttgacagctagctcagtcctaggtataatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z