BBa_K264003 1 BBa_K264003 Modular UP-element Design 4 2009-10-18T11:00:00Z 2015-05-08T01:11:42Z Rational redesign of BBa_K264000 The UP element is a component of the promoter located upstream of the -35 region. Though not necessary for transcription, the UP element increases the rate of transcription initiation by interacting with the alpha-subunit of RNA polymerase. A consensus sequence, -59 nnAAA(A/T)(A/T)T(A/T)TTTTnnAAAAnnn -38, was derived from a collection of many UP elements based on nucleotide frequency at each position (Estrem et al., 1998). UP Element Design 1 is the UP element with the highest transcription rate increase reported in that study. Design 1 was systematically modified (BBa_K264001-K264007) to vary the relative strength of its effect based on the hypothesis that the most significant promoter enhancement would occur when the UP element sequence used the most frequently-occurring nucleotides at each position (i.e., the consensus sequence). A spacer, CT, is placed between the UP element and subsequent promoters to maintain proper alignment with RNAP. false false _364_ 0 5271 9 Not in stock false The observed UP elements were A-T rich. Therefore, the rational sequence modifications of Design 1 were made to preserve this feature. Nucleotides in Design 1 at positions -59, -58, -54, and -45 were changed from G to A, G to A, A to T, and C to G, respectively. A spacer, CT, is placed between the UP element and subsequent promoters to maintain proper alignment with RNAP. false Adam Bower BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J06504 1 mCherry monomeric RFP optimized for bacteria 2005-07-17T11:00:00Z 2016-01-25T01:05:28Z mCherry from Roger Y. Tsien's lab, altered to be BioBrick compatible Released HQ 2013 mRFP (DsRed) derived, altered to be a biobrick by removing a PstI site and adding in the ends. false false _20_ 4206 340 20 In stock false <p> Made a point mutation to eliminate a PstI site in the middle and then added BioBrick ends using PCR. </p> <p> Sequenced using primers that bind to the pSB1A2 plasmid on either side of the brick. </p> true ytwang annotation1585833 1 C->T (removing PstI site) range1585833 1 352 352 annotation1585829 1 mCherry range1585829 1 1 711 BBa_J23112 1 BBa_J23112 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Released HQ 2013 Later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_K264053 1 BBa_K264053 K264003.J23112.scar.J06702 (UP/promoter/reporter) 2009-11-20T12:00:00Z 2015-05-08T01:11:43Z This is a composite part. This part is a combination of the UP-element/promoter composite part BBa_K264050 (K264003.J23112) and RFP reporter BBa_J06702. This measurement device was used to characterize BBa_K264050. false false _364_ 0 2920 9 Not in stock false None. false George McArthur IV component2224269 1 BBa_K264050 component2224281 1 BBa_J06702 annotation2224281 1 BBa_J06702 range2224281 1 68 936 annotation2224269 1 BBa_K264050 range2224269 1 1 59 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K264050 1 BBa_K264050 K264003.J23112 (UP/promoter) 2009-11-10T12:00:00Z 2015-05-08T01:11:43Z This is a composite part. This engineered part is a combination of UP element BBa_K264003 and constitutive promoter BBa_J23112. false false _364_ 0 2920 9 Not in stock false A spacer, CT, was placed at the end of the UP-element to serve as a 2 bp spacer between the UP-element and promoter. There is no scar between the UP-element and promoter. false George McArthur IV component2062627 1 BBa_J23112 component2062626 1 BBa_K264003 annotation2062627 1 BBa_J23112 range2062627 1 25 59 annotation2062626 1 BBa_K264003 range2062626 1 1 24 BBa_J06702 1 mCherry mCherry, bacterial with RBS and forward terminator 2005-07-24T11:00:00Z 2015-08-31T04:08:18Z Released HQ 2013 Combines BBa_B0015 forward terminator with BBa_J06602 mCherry, bacterial with RBS false false _20_ 0 340 20 In stock false true Yves Wang component1596432 1 BBa_B0010 component1596442 1 BBa_B0012 component1596419 1 BBa_B0034 component1596427 1 BBa_J06504 annotation1596432 1 BBa_B0010 range1596432 1 741 820 annotation1596442 1 BBa_B0012 range1596442 1 829 869 annotation1596427 1 BBa_J06504 range1596427 1 19 732 annotation1596419 1 BBa_B0034 range1596419 1 1 12 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_J23112_sequence 1 ctgatagctagctcagtcctagggattatgctagc BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K264053_sequence 1 aaaaatttttttttgaaaagtactctgatagctagctcagtcctagggattatgctagctactagagaaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_J06504_sequence 1 atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataa BBa_K264050_sequence 1 aaaaatttttttttgaaaagtactctgatagctagctcagtcctagggattatgctagc BBa_K264003_sequence 1 aaaaatttttttttgaaaagtact BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J06702_sequence 1 aaagaggagaaatactagatggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccttgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z