BBa_K270000 1 BBa_K270000 Pu Promoter 2009-09-19T11:00:00Z 2015-05-08T01:11:44Z NCBI: Pseudomonas putida plasmid pWW0 The Pu promoter is the upper pathway promoter for toluene degradation found on the TOL plasmid pWWO in P. putida mt-2. false false _368_ 0 4465 9 Not in stock true The Pu promoter is not annotated on the NCBI sequence and transcribes the XylU, XylW, XylM, XylA, XylB and XylN genes. A 400 bp region between the XylU gene and the tnpA transposase was selected for amplification by colony PCR where the promoter was believed to reside. false Ann Lesnefsky annotation2054889 1 pWW0 range2054889 1 1 137 annotation2054892 1 IHF range2054892 1 268 283 annotation2054890 1 Pu Promoter BBa_K270000 range2054890 1 138 338 annotation2054893 1 pWW0 range2054893 1 339 340 annotation2054891 1 UAS range2054891 1 165 214 BBa_K270000_sequence 1 cctgctggagggcgtgaacaaccgaatcaaggtgatcaagcgcatggcctatggtttccggggctcggactacttcttcctgaaagtcaaggctgtcttccccgggaaagcgcgatgaaccttttttatcgctgccttgatcaaatcgacaggtggttatgcgcgattgatgatttgctcaaatacagccagcgtgctgtagattttctctcataccccccctttcttttttacaaagaaaatcaataatttagatgaaataaggggatcggtataagcaatggcatggcggttgctagctatacgagacttaaaataaaaatagtggtgacccttcaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z