BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0030 1 BBa_B0030 RBS.1 (strong) -- modified from R. Weiss 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Strong RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _44_46_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;orig&quot; in figure 4-14 of Ron Weiss thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7025 1 BBa_B0030 range7025 1 1 15 annotation1702 1 RBS range1702 1 8 12 annotation1701 1 RBS-1\Strong range1701 1 1 15 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K270000 1 BBa_K270000 Pu Promoter 2009-09-19T11:00:00Z 2015-05-08T01:11:44Z NCBI: Pseudomonas putida plasmid pWW0 The Pu promoter is the upper pathway promoter for toluene degradation found on the TOL plasmid pWWO in P. putida mt-2. false false _368_ 0 4465 9 Not in stock true The Pu promoter is not annotated on the NCBI sequence and transcribes the XylU, XylW, XylM, XylA, XylB and XylN genes. A 400 bp region between the XylU gene and the tnpA transposase was selected for amplification by colony PCR where the promoter was believed to reside. false Ann Lesnefsky annotation2054889 1 pWW0 range2054889 1 1 137 annotation2054891 1 UAS range2054891 1 165 214 annotation2054892 1 IHF range2054892 1 268 283 annotation2054890 1 Pu Promoter BBa_K270000 range2054890 1 138 338 annotation2054893 1 pWW0 range2054893 1 339 340 BBa_K270003 1 BBa_K270003 Pu GFP 2009-10-18T11:00:00Z 2015-05-08T01:11:44Z See Bba_K270000 (Pu promoter) and Bba_E0840 (GFP generator) This device will characterize the activity of the Pu promoter using a GFP fluorescense signal. false false _368_ 0 4465 9 It's complicated true There are two RBS sites associated with this part, one on the Pu promoter and one on the GFP generator. false Ann Lesnefsky component2054918 1 BBa_B0030 component2054922 1 BBa_B0010 component2054924 1 BBa_B0012 component2054921 1 BBa_E0040 component2054916 1 BBa_K270000 annotation2054918 1 BBa_B0030 range2054918 1 349 363 annotation2054921 1 BBa_E0040 range2054921 1 370 1089 annotation2054916 1 BBa_K270000 range2054916 1 1 340 annotation2054924 1 BBa_B0012 range2054924 1 1186 1226 annotation2054922 1 BBa_B0010 range2054922 1 1098 1177 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0030_sequence 1 attaaagaggagaaa BBa_K270003_sequence 1 cctgctggagggcgtgaacaaccgaatcaaggtgatcaagcgcatggcctatggtttccggggctcggactacttcttcctgaaagtcaaggctgtcttccccgggaaagcgcgatgaaccttttttatcgctgccttgatcaaatcgacaggtggttatgcgcgattgatgatttgctcaaatacagccagcgtgctgtagattttctctcataccccccctttcttttttacaaagaaaatcaataatttagatgaaataaggggatcggtataagcaatggcatggcggttgctagctatacgagacttaaaataaaaatagtggtgacccttcaattactagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K270000_sequence 1 cctgctggagggcgtgaacaaccgaatcaaggtgatcaagcgcatggcctatggtttccggggctcggactacttcttcctgaaagtcaaggctgtcttccccgggaaagcgcgatgaaccttttttatcgctgccttgatcaaatcgacaggtggttatgcgcgattgatgatttgctcaaatacagccagcgtgctgtagattttctctcataccccccctttcttttttacaaagaaaatcaataatttagatgaaataaggggatcggtataagcaatggcatggcggttgctagctatacgagacttaaaataaaaatagtggtgacccttcaat BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z