BBa_K270006 1 BBa_K270006 Pr Promoter 2009-10-18T11:00:00Z 2015-05-08T01:11:44Z NCBI:Pseudomonas putida plasmid pWW0 Pr is a regulatory promoter for the toluene degradation pathway on the pWW0 plasmid. This is a constituative promoter that expresses the regulatory protien XylR. When no toluene is present XylR represses Pr. When toluene is present the XylR binds with the toluene and the activity of the Pr promoter increases. false false _368_ 0 4465 9 Not in stock false The Pr XylR basic parts were amplified together from the pWW0 plasmid using colony PCR. false Ann Lesnefsky annotation2054956 1 pWW0 range2054956 1 1 221 annotation2054958 1 UAS range2054958 1 254 270 annotation2054960 1 IHF range2054960 1 252 273 annotation2054957 1 Pr Promoter range2054957 1 222 421 annotation2054959 1 UAS range2054959 1 284 300 BBa_K270006_sequence 1 tgggctgcttggtgtgatgtagaaaggcgccaagtcgatgaaaatgcatctcgacgtgatgcgtatacgggttacccccattgccacgttgcgccatcctttttgcaatcagtgaccacttttccaagcaaaaataacgccaagcagaacgaagacgttctttttaagaagcgagaacaccagaagttcgtgctgtcggggcatgcggcgacgaattggcggataaaggggatctgcgttgaggtggatttcagttaatcaattggttaatctttcaggaccacctaagcaaatgctaaagtggcagatggaatgctgagccggcaagcacaggccttgacgttgcaaggtagtcatgaccgcagtgagcctctgatgttccgccgggtggatcatcccgataaaaacaagaggaaaacaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z