BBa_K145151 1 ccdB ccdB coding region 2008-08-06T11:00:00Z 2015-07-08T03:14:50Z P1010 Released HQ 2013 Coding region for the ccdB (control of cell death) gene. true false _257_ 4206 2970 9 In stock true just one stop codon in the end true Jonas Demeulemeester annotation1970252 1 stop range1970252 1 304 306 annotation1970253 1 cds range1970253 1 1 303 annotation1970251 1 start range1970251 1 1 3 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K272996 1 BBa_K272996 Rbs - ccdB toxin 2009-10-19T11:00:00Z 2015-07-09T01:01:57Z Registry of Standard Biological Parts Rbs - ccdB toxin true false _369_ 4206 5014 9 Not in stock false Standard Assembly false IIT_Madras 2009 component2056731 1 BBa_K145151 component2056727 1 BBa_B0034 annotation2056727 1 BBa_B0034 range2056727 1 1 12 annotation2056731 1 BBa_K145151 range2056731 1 19 324 BBa_B0034_sequence 1 aaagaggagaaa BBa_K145151_sequence 1 atgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa BBa_K272996_sequence 1 aaagaggagaaatactagatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z