BBa_K273003 1 BBa_K273003 Pirin like protein (pirB) from <i>Synechocystis sp PCC6803</i> 2009-08-31T11:00:00Z 2015-05-08T01:11:44Z Synechocystis sp PCC6803 genomic DNA Protein which is supposed to increase the pyruvate levels in Synechocystis sp PCC6803 in concert with pirA (<partinfo>BBa_K273002. Mechanism unkown, function yet to proof. false false _373_ 0 5250 9 Not in stock false none false Karl Brune annotation2018232 1 startcodon range2018232 1 1 3 annotation2018234 1 cds range2018234 1 1 234 annotation2018233 1 stopcodon (double) range2018233 1 235 240 BBa_K273003_sequence 1 atgactgaaccaaccattgccgatacaaaacccatggttatggagcttgaagccggagactattattggtgtgcctgcggcaattccaccaaccaacctttctgtgatggcaaacataaaggtacggggtttaccccacaaaagttcaccctagagaaatcacaaaaggtagccctgtgtctttgtaagcacaccgataatccccccttctgtgatggtgcccacgccaaactttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z