BBa_K273021 1 E1A2 E1A2 2009-10-16T11:00:00Z 2015-05-08T01:11:44Z Antisense RNA function supposed to fuction through either Shine Dalgarno blocking and/or RNA elongation blocking. E1A2 antisense RNA against the formation of pyruvate dehydrogenase complex (PDC). Target is pyruvate dehydrogenase E1 (EC 1.2.4.1), in partuclar the alfa subunit (A). Antisense approach number 1. Will be expressed with free biobrick interfaces which hopefully not affect performance. E1A1 E1: E1 enzyme subunit of the PDC complex A: Alpha subunit of the particular enzyme subunit 1: # of antisense RNA approach false false _373_ 0 5250 9 Not in stock false false Karl Brune BBa_K273021_sequence 1 ccatagtacaatttgcagtagataaagggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z