BBa_K273022 1 E1A3 E1A3 2009-10-16T11:00:00Z 2015-05-08T01:11:44Z Desigend by the Uppsala iGEM Team 2009 __NOTOC__ <partinfo>BBa_K273022 short</partinfo> E1A2 antisense RNA against the formation of pyruvate dehydrogenase complex (PDC). Target is pyruvate dehydrogenase E1 (EC 1.2.4.1), in partuclar the alfa subunit (A). Antisense RNA approach #3.<br> Will be transcribed together with the BioBrick interface and may affect the performance of the antisense RNA molecule.<br> EXYZ<br> EX: E1 enzyme subunit of the PDC complex<br> Y: a=Alpha subunit of the particular enzyme subunit<br> b=beta subunit of the particular enzyme subunit<br> Z: # of antisense RNA approach<br> ==Usage and Biology== Antisense RNA function supposed to fuction through either Shine Dalgarno blocking and/or RNA elongation blocking. false false _373_ 0 5250 9 Not in stock false BioBrick interace will be transcribed as well and may influence the performance of the antisense molecule. false Karl Brune BBa_K273022_sequence 1 tctgaaaccatagtacaatttgcagtagataaaggggaaggggttttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z