BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K273044 1 BBa_K273044 pPetE - E1A1 - Ter 2009-10-17T11:00:00Z 2015-05-08T01:11:45Z - - false false _373_ 0 5250 9 It's complicated false - false Karl Brune component2050046 1 BBa_B0012 component2050043 1 BBa_K273020 component2050042 1 BBa_K273019 component2050044 1 BBa_B0010 annotation2050044 1 BBa_B0010 range2050044 1 466 545 annotation2050046 1 BBa_B0012 range2050046 1 554 594 annotation2050043 1 BBa_K273020 range2050043 1 438 457 annotation2050042 1 BBa_K273019 range2050042 1 1 429 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K273019 1 PpetE PpetE 2009-10-17T11:00:00Z 2015-05-08T01:11:44Z - pPetE copper inducible promoter false false _373_ 0 5250 9 It's complicated true - false Karl Brune BBa_K273020 1 E1A1 E1A1 2009-10-15T11:00:00Z 2015-05-08T01:11:44Z Created with... Against target sequence ... E1A1 regulatory RNA against the Pyruvate dehydrogenase subunit one (E1), the alfa subunit of said protein (A, and number one such RNA created. Will be expressed with non free biobrick interfaces which hopefully not affect performance. false false _373_ 0 4680 9 Not in stock false - false Anders Kristoffersson BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K273044_sequence 1 tcatagcggttgcccaatctaactcagggagcgacttcagcccacaaaaaacaccactgggcctactgggctattcccattatcatctacattgaagggatagcaagctaatttttatgacggcgatcgccaaaaacaaagaaaattcagcaattaccgtgggtagcaaaaaatccccatctaaagttcagtaaatatagctagaacaaccaagcattttcggcaaagtactattcagatagaacgagaaatgagcttgttctatccgcccggggctgaggctgtataatctacgacgggctgtcaaacattgtgataccatgggcagaagaaaggaaaaacgtccctgatcgcctttttgggcacggagtagggcgttaccccggcccgttcaaccacaagtccctatagatacaatcgccaagaagttactagagaaggggaaggggttttatattactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K273020_sequence 1 aaggggaaggggttttatat BBa_K273019_sequence 1 tcatagcggttgcccaatctaactcagggagcgacttcagcccacaaaaaacaccactgggcctactgggctattcccattatcatctacattgaagggatagcaagctaatttttatgacggcgatcgccaaaaacaaagaaaattcagcaattaccgtgggtagcaaaaaatccccatctaaagttcagtaaatatagctagaacaaccaagcattttcggcaaagtactattcagatagaacgagaaatgagcttgttctatccgcccggggctgaggctgtataatctacgacgggctgtcaaacattgtgataccatgggcagaagaaaggaaaaacgtccctgatcgcctttttgggcacggagtagggcgttaccccggcccgttcaaccacaagtccctatagatacaatcgccaagaagt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z