BBa_K273021 1 E1A2 E1A2 2009-10-16T11:00:00Z 2015-05-08T01:11:44Z Antisense RNA function supposed to fuction through either Shine Dalgarno blocking and/or RNA elongation blocking. E1A2 antisense RNA against the formation of pyruvate dehydrogenase complex (PDC). Target is pyruvate dehydrogenase E1 (EC 1.2.4.1), in partuclar the alfa subunit (A). Antisense approach number 1. Will be expressed with free biobrick interfaces which hopefully not affect performance. E1A1 E1: E1 enzyme subunit of the PDC complex A: Alpha subunit of the particular enzyme subunit 1: # of antisense RNA approach false false _373_ 0 5250 9 Not in stock false false Karl Brune BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K273019 1 PpetE PpetE 2009-10-17T11:00:00Z 2015-05-08T01:11:44Z - pPetE copper inducible promoter false false _373_ 0 5250 9 It's complicated true - false Karl Brune BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K273045 1 BBa_K273045 pPetE - E1A2 - Ter 2009-10-17T11:00:00Z 2015-05-08T01:11:45Z - - false false _373_ 0 5250 9 It's complicated false - false Karl Brune component2050052 1 BBa_B0010 component2050054 1 BBa_B0012 component2050050 1 BBa_K273019 component2050051 1 BBa_K273021 annotation2050054 1 BBa_B0012 range2050054 1 564 604 annotation2050050 1 BBa_K273019 range2050050 1 1 429 annotation2050051 1 BBa_K273021 range2050051 1 438 467 annotation2050052 1 BBa_B0010 range2050052 1 476 555 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K273045_sequence 1 tcatagcggttgcccaatctaactcagggagcgacttcagcccacaaaaaacaccactgggcctactgggctattcccattatcatctacattgaagggatagcaagctaatttttatgacggcgatcgccaaaaacaaagaaaattcagcaattaccgtgggtagcaaaaaatccccatctaaagttcagtaaatatagctagaacaaccaagcattttcggcaaagtactattcagatagaacgagaaatgagcttgttctatccgcccggggctgaggctgtataatctacgacgggctgtcaaacattgtgataccatgggcagaagaaaggaaaaacgtccctgatcgcctttttgggcacggagtagggcgttaccccggcccgttcaaccacaagtccctatagatacaatcgccaagaagttactagagccatagtacaatttgcagtagataaaggggtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K273021_sequence 1 ccatagtacaatttgcagtagataaagggg BBa_K273019_sequence 1 tcatagcggttgcccaatctaactcagggagcgacttcagcccacaaaaaacaccactgggcctactgggctattcccattatcatctacattgaagggatagcaagctaatttttatgacggcgatcgccaaaaacaaagaaaattcagcaattaccgtgggtagcaaaaaatccccatctaaagttcagtaaatatagctagaacaaccaagcattttcggcaaagtactattcagatagaacgagaaatgagcttgttctatccgcccggggctgaggctgtataatctacgacgggctgtcaaacattgtgataccatgggcagaagaaaggaaaaacgtccctgatcgcctttttgggcacggagtagggcgttaccccggcccgttcaaccacaagtccctatagatacaatcgccaagaagt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z