BBa_K273022 1 E1A3 E1A3 2009-10-16T11:00:00Z 2015-05-08T01:11:44Z Desigend by the Uppsala iGEM Team 2009 __NOTOC__ <partinfo>BBa_K273022 short</partinfo> E1A2 antisense RNA against the formation of pyruvate dehydrogenase complex (PDC). Target is pyruvate dehydrogenase E1 (EC 1.2.4.1), in partuclar the alfa subunit (A). Antisense RNA approach #3.<br> Will be transcribed together with the BioBrick interface and may affect the performance of the antisense RNA molecule.<br> EXYZ<br> EX: E1 enzyme subunit of the PDC complex<br> Y: a=Alpha subunit of the particular enzyme subunit<br> b=beta subunit of the particular enzyme subunit<br> Z: # of antisense RNA approach<br> ==Usage and Biology== Antisense RNA function supposed to fuction through either Shine Dalgarno blocking and/or RNA elongation blocking. false false _373_ 0 5250 9 Not in stock false BioBrick interace will be transcribed as well and may influence the performance of the antisense molecule. false Karl Brune BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K273019 1 PpetE PpetE 2009-10-17T11:00:00Z 2015-05-08T01:11:44Z - pPetE copper inducible promoter false false _373_ 0 5250 9 It's complicated true - false Karl Brune BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K273046 1 BBa_K273046 pPetE - E1A3 - Ter 2009-10-17T11:00:00Z 2015-05-08T01:11:45Z - - false false _373_ 0 5250 9 It's complicated false - false Karl Brune component2050062 1 BBa_B0012 component2050060 1 BBa_B0010 component2050059 1 BBa_K273022 component2050058 1 BBa_K273019 annotation2050059 1 BBa_K273022 range2050059 1 438 487 annotation2050060 1 BBa_B0010 range2050060 1 496 575 annotation2050058 1 BBa_K273019 range2050058 1 1 429 annotation2050062 1 BBa_B0012 range2050062 1 584 624 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K273046_sequence 1 tcatagcggttgcccaatctaactcagggagcgacttcagcccacaaaaaacaccactgggcctactgggctattcccattatcatctacattgaagggatagcaagctaatttttatgacggcgatcgccaaaaacaaagaaaattcagcaattaccgtgggtagcaaaaaatccccatctaaagttcagtaaatatagctagaacaaccaagcattttcggcaaagtactattcagatagaacgagaaatgagcttgttctatccgcccggggctgaggctgtataatctacgacgggctgtcaaacattgtgataccatgggcagaagaaaggaaaaacgtccctgatcgcctttttgggcacggagtagggcgttaccccggcccgttcaaccacaagtccctatagatacaatcgccaagaagttactagagtctgaaaccatagtacaatttgcagtagataaaggggaaggggttttatatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K273019_sequence 1 tcatagcggttgcccaatctaactcagggagcgacttcagcccacaaaaaacaccactgggcctactgggctattcccattatcatctacattgaagggatagcaagctaatttttatgacggcgatcgccaaaaacaaagaaaattcagcaattaccgtgggtagcaaaaaatccccatctaaagttcagtaaatatagctagaacaaccaagcattttcggcaaagtactattcagatagaacgagaaatgagcttgttctatccgcccggggctgaggctgtataatctacgacgggctgtcaaacattgtgataccatgggcagaagaaaggaaaaacgtccctgatcgcctttttgggcacggagtagggcgttaccccggcccgttcaaccacaagtccctatagatacaatcgccaagaagt BBa_K273022_sequence 1 tctgaaaccatagtacaatttgcagtagataaaggggaaggggttttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z