BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_I746351 1 BBa_I746351 pag activator from PSP3 phage 2007-09-11T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The pag activator taken from PSP3 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943869 1 PSP3 pag range1943869 1 19 19 annotation1943870 1 PSP3 pag range1943870 1 19 237 annotation1943868 1 B0034 range1943868 1 1 12 BBa_I746360 1 BBa_I746360 PF promoter from P2 phage 2007-09-10T11:00:00Z 2015-08-31T04:08:04Z The original source is the P2 phage genome. For our work the DNA came from plasmids, kindly supplied to us by Prof. Calendar, University of California (Berkeley): Bacteriophage PSP3 and fR73 Activator Proteins: Analysis of Promoter Specificities; Julien and Calendar, 1996; JOURNAL OF BACTERIOLOGY, Oct. 1996, p. 5668???5675 Released HQ 2013 This is the PF promoter taken from the P2 phage genome. It is an inducible promoter that is activated by a class of activators, including P2 ogr (I746350), PSP3 pag (I746351) and phiR73 delta (I746352). These different activators should cause different levels of activity of the PF promoter. false false _116_ 0 2122 9 In stock false no special considerations seemed necessary true Stefan Milde annotation1943783 1 PF range1943783 1 1 91 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_K274380 1 BBa_K274380 PoPS -> PSP3 pag - PF promoter -> PoPS 2009-10-18T11:00:00Z 2015-05-08T01:11:45Z n/a n/a false false _374_ 0 5448 9 Not in stock false n/a false Vivian Mullin component2055333 1 BBa_B0012 component2055331 1 BBa_B0010 component2055338 1 BBa_I746360 component2055330 1 BBa_I746351 annotation2055331 1 BBa_B0010 range2055331 1 246 325 annotation2055333 1 BBa_B0012 range2055333 1 334 374 annotation2055338 1 BBa_I746360 range2055338 1 383 473 annotation2055330 1 BBa_I746351 range2055330 1 1 237 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K274380_sequence 1 aaagaggagaaatactagatgatgcactgcccgttatgccaaaacgctgcacatgctcgcactagccggtaccttagcaccgaaacgaaagaacgttatcaccagtgccaaaacataaattgcggatgtacatttatcacttttgagacactatcaagattcattgtgaaaccggggactgttgatcctgctccgccccaccccatcagaaaccaacaacagcaactttggctttgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagttgcccgccttttctttaccggtggttgtgctgtcgattagccaaccgggacaaatagcctgacatctccggcgcaactgaaaataccact BBa_I746351_sequence 1 aaagaggagaaatactagatgatgcactgcccgttatgccaaaacgctgcacatgctcgcactagccggtaccttagcaccgaaacgaaagaacgttatcaccagtgccaaaacataaattgcggatgtacatttatcacttttgagacactatcaagattcattgtgaaaccggggactgttgatcctgctccgccccaccccatcagaaaccaacaacagcaactttggctttga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I746360_sequence 1 ttgcccgccttttctttaccggtggttgtgctgtcgattagccaaccgggacaaatagcctgacatctccggcgcaactgaaaataccact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z