BBa_K277019 1 BBa_K277019 3L.3_23.A2.07 2009-10-19T11:00:00Z 2015-05-08T01:11:45Z Synthetic Yeast 3L.3_23.A2.07 is 815 bases long and is cloned into the pGem-T vector. 3L.3_23.A2.07 was designed as a piece of synthetic chromosome 3 with the goal of minimizing and stabilizing that chromosome and to that end has had any tRNAs, introns, repeat regions, and transposons that were present in the wildtype chromosome removed. In addition a very few gene sequences were slightly recoded to add or remove restriction enzyme recognition sites to facilitate assembly; most gene sequences were slightly recoded to introduce unique primers for diagnostic PCR amplification, and some gene sequences were slightly recoded to address the distribution of stop codon usage. 3L.3_23.A2.07 is a constituent of 3L.3_23.A2 (along with 3L.3_23.A2.01, 3L.3_23.A2.02, 3L.3_23.A2.03, 3L.3_23.A2.04, 3L.3_23.A2.05, 3L.3_23.A2.06, 3L.3_23.A2.08, 3L.3_23.A2.09, 3L.3_23.A2.10, 3L.3_23.A2.11, 3L.3_23.A2.12, 3L.3_23.A2.13, and 3L.3_23.A2.14.) This part contains at least part of the following features (positions offset from first base of sequence): kind and name offset notes gene YCL059C (-715..235) Essential nucleolar protein required for the synthesis of 18S rRNA and for the assembly of 40S ribosomal subunit gene YCL058W-A (440..781) Protein of unknown function%3B identified by homology to Ashbya gossypii mutation_affecting_coding_sequence YCL058C_stop_recode_overlap_from_YCL058W-A (781..781) Overlaps stop codon change in YCL058W-A gene YCL058C (379..+837) Protein of unknown function%2C required for survival upon exposure to K1 killer toxin%3B involved in ion homeostasis Sequence (the first 815 bases correspond to coordinates 13280..14094 in synthetic chromosome yeast_chr3_3_23) false false _385_ 0 2669 9 It's complicated false Constructed using overlap extension PCR protocol described in RFC38 false James DiCarlo BBa_K277019_sequence 1 aaccttcgactaaatctagaacacacgctatgttgtgtttgtctagagcccttgttacatcattccaaatcgtcttcaagtaactttctctgtatttaggaaacaaagtcataaaactggactcttcagcaaaaggttgaccggatgcgttatcctcttccttaaactcctctatcttccatttatcaatatcatccgtatcccaaggtttatctctgttatgtgtagacaccatcgtttgccaatttggatatttgtgtgacccttttgtttgctgtctactttacaatagttaacctcatcatctcttttttttgaaaattttcatatctcatcgctaaaagaattagaaatataaggaaaaaaaaattttcgttttcagatgtgcaagcctgctataataaggtacaataactcaagggcatttagcaaggaaaaaatgggcaagtgtagcatgaaaaagaaaggtgtgggcaagaatgttggtgttggcaagaaagtacaaaaaaagaggtcgatcagcaccgctgaaaggaagagaacaaagttacaagtggaaaagttaaacaaaagtagtgaaacaatgataccgacgctgctgcgggaggcaagtacacaagagccagctaaactgaaagctgagactactttgaaagccgaggagctgatcaaggaccaggaaaaggactccaaggtacgagagcaaattcggacagaaaaatcaaaaacaaacgacagcatgctgaagcagatcgaaatgatatccggcttttccttataaggaatagtggtgaaagttacgtaaatatatacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z