BBa_K277046 1 BBa_K277046 3L.3_23.B2.06 2009-10-20T11:00:00Z 2015-05-08T01:11:46Z Synthetic Yeast 3L.3_23.B2.06 is 748 bases long and is cloned into the pGem-T vector. 3L.3_23.B2.06 was designed as a piece of synthetic chromosome 3 with the goal of minimizing and stabilizing that chromosome and to that end has had any tRNAs, introns, repeat regions, and transposons that were present in the wildtype chromosome removed. In addition a very few gene sequences were slightly recoded to add or remove restriction enzyme recognition sites to facilitate assembly; most gene sequences were slightly recoded to introduce unique primers for diagnostic PCR amplification, and some gene sequences were slightly recoded to address the distribution of stop codon usage. 3L.3_23.B2.06 is a constituent of 3L.3_23.B2 (along with 3L.3_23.B2.01, 3L.3_23.B2.02, 3L.3_23.B2.03, 3L.3_23.B2.04, 3L.3_23.B2.05, 3L.3_23.B2.07, 3L.3_23.B2.08, 3L.3_23.B2.09, 3L.3_23.B2.10, 3L.3_23.B2.11, and 3L.3_23.B2.12.) This part contains at least part of the following features (positions offset from first base of sequence): kind and name offset notes gene YCL048W (-890..501) Protein of unknown function%2C redundant with Sps2p for the organization of the beta-glucan layer of the spore wall mutation_affecting_coding_sequence YCL048W_re_remove_MmeI (232..243) removal of MmeI gene YCL047C (640..+1416) Hypothetical protein loxP_site loxPsym_YCL048W (505..538) Sequence (the first 748 bases correspond to coordinates 33327..34074 in synthetic chromosome yeast_chr3_3_23) false false _385_ 0 2669 9 It's complicated false Constructed using overlap extension PCR protocol described in RFC38 false James DiCarlo BBa_K277046_sequence 1 acattaggaattatcaacaatgtaaatttaataaaagttaatttggagaacttaacagacattcaaggtggcttgatgatcgccgataacgaatccctcgaggatattactttcctgccaaacttgaagcagattggaggtgctattttctttgaaggttcgttcaaagatatcatgttcgatagcttgaaactggtgaaaggtagcgcttttattaagagttcatcaaacgtattggattgcaataaatggacaaacccatcaaatggaagatcaatcatcaggggtgggaaattcacttgtatttctggtaagaaggaaaatacgctgaatgttaaacaggatggtacaatcatagaaaaagggtacaaagatttaacgcaagaaggtgaagactccaagaaaagagtgatttcaaaatacgcgaactcagcaaatccaagcatgcaattggacccccttctttttggtacatgccttgttgctatgttattgttttaagatataacttcgtataatgtacattatacgaagttattactagtctagtataacagaaagttttttttgttcctaatattatctttatctatatacatatatctccatgaaaggcatttgaatttctatctttctctttcaatcaaatattgtcttattattgatcaaataatcgtatatgcacaatggcaactcgtctttcaaactctccacttgcccattcttcagtttgttcctaatctcggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z