BBa_K277057 1 BBa_K277057 3L.3_23.B3.05 2009-10-20T11:00:00Z 2015-05-08T01:11:46Z Synthetic Yeast 3L.3_23.B3.05 is 774 bases long and is cloned into the pGem-T vector. 3L.3_23.B3.05 was designed as a piece of synthetic chromosome 3 with the goal of minimizing and stabilizing that chromosome and to that end has had any tRNAs, introns, repeat regions, and transposons that were present in the wildtype chromosome removed. In addition a very few gene sequences were slightly recoded to add or remove restriction enzyme recognition sites to facilitate assembly; most gene sequences were slightly recoded to introduce unique primers for diagnostic PCR amplification, and some gene sequences were slightly recoded to address the distribution of stop codon usage. 3L.3_23.B3.05 is a constituent of 3L.3_23.B3 (along with 3L.3_23.B3.01, 3L.3_23.B3.02, 3L.3_23.B3.03, 3L.3_23.B3.04, 3L.3_23.B3.06, 3L.3_23.B3.07, 3L.3_23.B3.08, and 3L.3_23.B3.09.) This part contains at least part of the following features (positions offset from first base of sequence): kind and name offset notes mutation_affecting_coding_sequence YCL040W_re_remove_MmeI (127..138) removal of MmeI reverse_primer YCL040W_tagr1v1 (699..723) mutation_affecting_coding_sequence YCL040W_re_remove_Bpu10I (79..87) removal of Bpu10I gene YCL040W (-530..+972) Glucokinase%2C catalyzes the phosphorylation of glucose at C6 in the first irreversible step of glucose metabolism%3B one of three glucose phosphorylating enzymes%3B expression regulated by non-fermentable carbon sources mutation_affecting_coding_sequence YCL040W_re_remove_BpuEI (358..366) removal of BpuEI forward_primer YCL040W_tagf1v1 (405..432) forward_primer YCL040W_tagf2v1 (567..594) Sequence (the first 774 bases correspond to coordinates 41708..42481 in synthetic chromosome yeast_chr3_3_23) false false _385_ 0 2669 9 It's complicated false Constructed using overlap extension PCR protocol described in RFC38 false James DiCarlo BBa_K277057_sequence 1 atcaggtggaccaagggtttccgcatcgcggacaccgtcgggaaggatgtcgtgcaattgtaccaggagcaattaagcgctcaaggtatgcctatgatcaaggttgttgcattaaccaacgacaccgtcgggacgtacctatcgcattgctacacgtccgataacacggactcaatgacgtccggagaaatctcggagccggtcatcggatgtattttcggtaccggtaccaatgggtgctatatggaggagatcaacaagatcacgaagttgccacaggagttgcgtgacaagttgataaaggagggtaagacacacatgatcatcaatgtcgaatgggggtccttcgataatgagctgaagcacttgcctactactaagtatgacgtcgtaattgaccagaagttgagcaccaatccaggtttccatctatttgaaaaacgtgtctcagggatgttcttgggtgaggtgttgcgtaacattttagtggacttgcactcgcaaggcttgcttttgcaacagtacaggtccaaggaacaacttcctcgccacttgactacaccttttcaactaagcagcgaagttttgagccacattgaaattgacgactcgacaggtctacgtgaaacagagttgtcattattacagagtctcagactgcccaccaccccaacagagcgtgttcaaattcaaaaattagttcgagctatcagccgacgaagcgcgtatttagccgccgtgccgcttgccgcgatattgatcaagacaaatgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z