BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K283008 1 BBa_K283008 chez_Histag 2009-10-12T11:00:00Z 2015-05-08T01:11:47Z self-designed This part consists of a chez coding region followed by a 6-Histidine tail false false _383_ 0 5494 9 It's complicated true BBa_K283008 false W Ling , Nelson Chu, Shi Lei annotation2035289 1 cheZ range2035289 1 1 645 annotation2035366 1 6-His tag range2035366 1 696 713 annotation2035290 1 BBa_K094100 range2035290 1 1 695 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation2213989 1 Help:Barcodes range2213989 1 661 685 annotation23329 1 tetR range23329 1 4 620 annotation23330 1 SsrA range23330 1 621 654 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 BBa_K283002 1 BBa_K283002 Speed control device (pLacI-rbs-TetR-terminator-ptet-rbs-chez_his-double terminators) 2009-10-12T11:00:00Z 2015-05-08T01:11:47Z The rbs, terminator and the pLac promoter are from the registry, the rest of the part are self designed This is a device that enable the control of chez(histag) using IPTG. The pLacIq promoter enables high level of expression of the LacI repressor protein. The LacI protein represses the Plac promoter. IPTG binds with LacI repressor protein and remove the inhibiting effect of the LacI on the pLac promoter. false false _383_ 0 5494 9 Not in stock true BBa_K283002 false Shi Lei, Nelson Chu, W Ling component2287616 1 BBa_B0010 component2287611 1 BBa_B0034 component2287628 1 BBa_B0034 component2287618 1 BBa_B0012 component2287632 1 BBa_K283008 component2287622 1 BBa_R0040 component2287615 1 BBa_C0040 component2287603 1 BBa_R0010 component2287635 1 BBa_B0012 component2287633 1 BBa_B0010 annotation2287622 1 BBa_R0040 range2287622 1 1057 1110 annotation2287603 1 BBa_R0010 range2287603 1 1 200 annotation2287632 1 BBa_K283008 range2287632 1 1137 1849 annotation2287635 1 BBa_B0012 range2287635 1 1946 1986 annotation2287611 1 BBa_B0034 range2287611 1 209 220 annotation2287615 1 BBa_C0040 range2287615 1 227 911 annotation2287628 1 BBa_B0034 range2287628 1 1119 1130 annotation2287618 1 BBa_B0012 range2287618 1 1008 1048 annotation2287616 1 BBa_B0010 range2287616 1 920 999 annotation2287633 1 BBa_B0010 range2287633 1 1858 1937 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986787 1 -10 range1986787 1 43 48 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K283008_sequence 1 atgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttgagctagcaacgcaatgacgtcggaattgccagctggggcgccctctggtaacatcatcaccatcaccac BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_K283002_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttgagctagcaacgcaatgacgtcggaattgccagctggggcgccctctggtaacatcatcaccatcaccactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z