BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K283031 1 BBa_K283031 FF_FF ansB promoter (E.coli) 2009-10-13T11:00:00Z 2015-05-08T01:11:47Z BBa_283030 inducible hypoxia promoter false false _383_ 0 5494 9 Not in stock false BBa_283030 false Shi Lei annotation2056552 1 FNR range2056552 1 1 24 annotation2056551 1 promoter range2056551 1 1 105 annotation2056553 1 FNR range2056553 1 53 74 BBa_K283018 1 BBa_K283018 FF-FF ansB promoter -rbs 2009-10-12T11:00:00Z 2015-05-08T01:11:47Z The panas promoter is self-designed The rbs is from the registry panas promoter with a rbs. The panas promoter is hypoxia inducible. false false _383_ 0 5494 9 It's complicated true BBa_K283018 false Shi Lei, W Ling , Nelson Chu component2047407 1 BBa_K283031 component2047409 1 BBa_B0034 annotation2047407 1 BBa_K283031 range2047407 1 1 105 annotation2047409 1 BBa_B0034 range2047409 1 114 125 BBa_B0034_sequence 1 aaagaggagaaa BBa_K283031_sequence 1 ttttttgttacctgcctctaactttgtagatctccaaaatatattcacgttgtaaattgtttaacgtcaaatttcccatacagagctaagggataatgcgtagcg BBa_K283018_sequence 1 ttttttgttacctgcctctaactttgtagatctccaaaatatattcacgttgtaaattgtttaacgtcaaatttcccatacagagctaagggataatgcgtagcgtactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z