BBa_K283022 1 BBa_K283022 pLacI-rbs-cheZ 2009-10-12T11:00:00Z 2015-05-08T01:11:47Z The chez coding region is self-designed The rbs and the pLac promomter are from the registry This part consist of a chez downstream of a pLac promoter. The cheZ protein is responsible for the dephosphorylation of cheY protein in bacteria flagella movement. The pLac promoter can be repressed by LacI protein false false _383_ 0 5494 9 It's complicated true BBa_K283022 false Nelson Chu, W Ling , Shi Lei component2035699 1 BBa_R0010 component2035707 1 BBa_B0034 component2035709 1 BBa_K094100 annotation2035707 1 BBa_B0034 range2035707 1 209 220 annotation2035709 1 BBa_K094100 range2035709 1 227 921 annotation2035699 1 BBa_R0010 range2035699 1 1 200 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_K094100 1 BBa_K094100 cheZ gene 2008-10-12T11:00:00Z 2015-05-08T01:08:40Z The origin of the cheZ gene comes from E. Coli strain MG1655 chromosome. This part contains the cheZ operon coding region without an rbs nor a terminator. cheZ protein is responsible for the dephosphorylation of cheY protein in bacteria flagella movement. false false _255_ 0 2589 9 It's complicated false This part is without promoter, rbs or terminator. false Liu Chenli annotation1980478 1 cheZ range1980478 1 1 645 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K283022_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttgagctagcaacgcaatgacgtcggaattgccagctggggcgccctctggtaa BBa_K094100_sequence 1 atgatgcaaccatcaatcaaacctgctgacgagcattcagctggcgatatcattgcgcgcatcggcagcctgacgcgtatgctgcgcgacagtttgcgggaactggggctggatcaggccattgccgaagcggcggaagccatccccgatgcgcgcgatcgtttgtactatgttgtgcagatgaccgcccaggctgcggagcgggcgctgaacagtgttgaggcgtcacaaccgcatcaggatcaaatggagaaatcagcaaaagcgttaacccaacgttgggatgactggtttgccgatccgattgaccttgccgacgcccgtgaactggtaacagatacacgacaatttctggcagatgtacccgcgcataccagctttactaacgcgcaactgctggaaatcatgatggcgcaggattttcaggatctcaccgggcaggtcattaagcggatgatggatgtcattcaggagatcgaacgccagttgctgatggtgctgttggaaaacatcccggaacaggagtcgcgtccaaaacgtgaaaaccagagtttgcttaatggacctcaggtcgataccagcaaagccggtgtggtagccagtcaggatcaggtggacgatttgttggatagtcttggattttgagctagcaacgcaatgacgtcggaattgccagctggggcgccctctggtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z