BBa_K284007 1 BBa_K284007 tra operon promoter (Py) 2009-08-05T11:00:00Z 2015-05-08T01:11:48Z F-plasmid of Escherichia coli. Py is the tra operon promoter of F-plasmid. It is repressed by the host nucleoid-associated protein, H-NS and activeted by TraJ protein. Conflicting evidence suggests that TraY can act as both an activator and a repressor. The tra operon encodes F-plasmid proteins (except TraJ and TraM) involved in DNA transfer by conjugation in E.coli. false false _386_ 0 4967 9 Not in stock false The mechanism for controlling transcription from Py remains undefined. The Py region contains significant intrinsic curvature, which could interfere in the regulation. false Maria Carolina de Barros Grassi annotation2015146 1 Tray binding site range2015146 1 50 75 annotation2015148 1 -10 range2015148 1 34 39 annotation2015147 1 -35 range2015147 1 11 16 BBa_K284007_sequence 1 tttccgtctatttaccttttctgattattctgcaaacataagtggtaaccagaagataaacagcgggaggtgtta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z