BBa_K284008 1 BBa_K284008 tra operon promoter (Py) 2009-08-05T11:00:00Z 2015-05-08T01:11:48Z F-plasmid of Escherichia coli. Py is the tra operon promoter of F-plasmid. It is repressed by the host nucleoid-associated protein, H-NS and activeted by TraJ protein. Conflicting evidence suggests that TraY can act as both an activator and a repressor. The tra operon encodes F-plasmid proteins (except TraJ and TraM) involved in DNA transfer by conjugation in E.coli. The regions shows intrinsic curvature, which could interfere in regulation. For this reason, the two closer bends upstream promoter region are included. false false _386_ 0 4966 9 It's complicated true The mechanism for controlling transcription from Py remains undefined. The Py region contains significant intrinsic curvature, which could interfere in regulation false Fabiana de Melo Duarte, Leonardo Minete, Maria Carolina Grassi and Lucas P. Parizzi annotation2015149 1 Tray binding site range2015149 1 108 133 annotation2015150 1 -35 range2015150 1 69 74 annotation2015153 1 bend range2015153 1 17 44 annotation2015151 1 -10 range2015151 1 92 97 annotation2015152 1 bend range2015152 1 47 68 BBa_K284008_sequence 1 acgagaaggctatgtgtatcataaatacgcgttaataaggtgttaataaaatatagactttccgtctatttaccttttctgattattctgcaaacataagtggtaaccagaagataaacagcgggaggtgtta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z