BBa_K284011 1 BBa_K284011 Forward Primer to BBa_K284003 2009-10-11T11:00:00Z 2015-05-08T01:11:48Z . . false false _386_ 0 4968 9 Not in stock false . false Ta??s Sineiro Herig and Gleidson Silva Teixeira annotation2034985 1 DLD Promoter F range2034985 1 1 21 BBa_K284011_sequence 1 ggtcgctctttctctctctcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z