BBa_K112806 1 BBa_K112806 [T4 endolysin] 2008-10-31T12:00:00Z 2015-05-08T01:09:19Z Enterobacteria phage T4 http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?val=29366675&from=66503&to=66997&view=gbwithparts Released HQ 2013 The lysozyme from enterobacteria phage T4 degrades peptidoglycan layer. false true _224_ 0 3025 171 In stock false High expression of lysozyme only is toxic to bacteria. false Jin Huh annotation1999018 1 T4 Endolysin range1999018 1 17 511 BBa_K284022 1 BBa_K284022 T4 endolysin under the control of T7 promotor 2009-10-13T11:00:00Z 2015-05-08T01:11:48Z This device is a junction of previously designed parts: BBa_I746911 - Designed by Stefan Milde Group: iGEM07_Cambridge (2008-09-30) BBa_K112806 - Designed by Jin Huh Group: iGEM08_UC_Berkeley (2008-10-31) Bba_B0014 - Designed by Reshma Shetty Group: Registry (2003-07-16) This construction is a device composed of: BBa_I746911 - BBa_K112806 - Bba_B0014. This device contain the T4 endolysin, a lysozyme from enterobacteria phage, that degrades peptidoglycan layer, under the control of the T7 promoter. false false _386_ 0 4973 9 It's complicated true For more accurate tests about the endolysin effectiveness, this part has to be under the control of an inducible promoter, like the T7 promoter. false Ane Fernanda Beraldi Zeidler, Luige A. Llerena Calder??n and Marcos Henrique de Moraes component2058982 1 BBa_I719005 component2058986 1 BBa_K112806 component2058991 1 BBa_B0011 component2058984 1 BBa_B0034 component2058987 1 BBa_B0012 annotation2058991 1 BBa_B0011 range2058991 1 623 668 annotation2058984 1 BBa_B0034 range2058984 1 32 43 annotation2058987 1 BBa_B0012 range2058987 1 574 614 annotation2058982 1 BBa_I719005 range2058982 1 1 23 annotation2058986 1 BBa_K112806 range2058986 1 52 565 BBa_I719005 1 pT7 T7 Promoter 2007-10-23T11:00:00Z 2015-08-31T04:07:53Z --- Released HQ 2013 Just a T7 Promoter false false _128_ 0 2097 9 In stock true None true Imperial 2007 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_I719005_sequence 1 taatacgactcactatagggaga BBa_B0034_sequence 1 aaagaggagaaa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_K284022_sequence 1 taatacgactcactatagggagatactagagaaagaggagaaatactagagatacttaggaggtattatgaatatatttgaaatgttacgtatagatgaaggtcttagacttaaaatctataaagacacagaaggctattacactattggcatcggtcatttgcttacaaaaagtccatcacttaatgctgctaaatctgaattagataaagctattgggcgtaattgcaatggtgtaattacaaaagatgaggctgaaaaactctttaatcaggatgttgatgctgctgttcgcggaatcctgagaaatgctaaattaaaaccggtttatgattctcttgatgcggttcgtcgctgtgcattgattaatatggttttccaaatgggagaaaccggtgtggcaggatttactaactctttacgtatgcttcaacaaaaacgctgggatgaagcagcagttaacttagctaaaagtagatggtataatcaaacacctaatcgcgcaaaacgagtcattacaacgtttagaactggcacttgggacgcgtataaaaatctataaagctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K112806_sequence 1 atacttaggaggtattatgaatatatttgaaatgttacgtatagatgaaggtcttagacttaaaatctataaagacacagaaggctattacactattggcatcggtcatttgcttacaaaaagtccatcacttaatgctgctaaatctgaattagataaagctattgggcgtaattgcaatggtgtaattacaaaagatgaggctgaaaaactctttaatcaggatgttgatgctgctgttcgcggaatcctgagaaatgctaaattaaaaccggtttatgattctcttgatgcggttcgtcgctgtgcattgattaatatggttttccaaatgggagaaaccggtgtggcaggatttactaactctttacgtatgcttcaacaaaaacgctgggatgaagcagcagttaacttagctaaaagtagatggtataatcaaacacctaatcgcgcaaaacgagtcattacaacgtttagaactggcacttgggacgcgtataaaaatctataaagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z