BBa_K285101 1 cadA promo cadA regulatory region 2009-08-09T11:00:00Z 2015-05-08T01:11:48Z 48 bases upstream of cadA gene in B. subtilis. strain 168. Regulatory sequence upstream of the cadA gene (previously known as yvgW). This sequence is part of the czrA regulon and is regulated by the CzrA repressor which is derepressed in the presence of Cd2+. false false _389_ 0 5327 9 It's complicated false None. false Xing Xiong BBa_K285101_sequence 1 ttttgtttttcattgacactttcttggaaaacaacatataataggtgtaacttatatatgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z