BBa_K285102 1 copZA prom copZA regulatory region 2009-08-09T11:00:00Z 2015-05-08T01:11:48Z 43 bases upstream of the copZA genes. Regulatory region of the copZA gene (previously known as yvgY). Activation of the copZ gene proceeds by copper mediated induction by the CueR protein which binds to this region. false false _389_ 0 5327 9 Not in stock false None. false Xing Xiong BBa_K285102_sequence 1 ttattgtaataccctacgggggtatggtaggatgaaaatagaaagaataaacagga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z