BBa_K285103 1 BBa_K285103 mntH regulatory region 2009-08-09T11:00:00Z 2015-05-08T01:11:48Z adsfdf This regulatory region of upstream of the mntH gene is repressed by the MntR protein which is derepressed upon induction by Cd2+. false false _389_ 0 5327 9 Not in stock false None false Xing Xiong BBa_K285103_sequence 1 ttgacaagaaaccgggatggtcatatgatgtagataaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z