BBa_K292008 1 BBa_K292008 SV40 nucleus targeting sequence (DTS) 2009-10-18T11:00:00Z 2015-05-08T01:11:49Z Nucleus targeting sequance form SV40. This part contains a SV40 nucleus targeting sequence (DTS). This part is reliable to use to increase the level of gene transfection efficiency. Any plasmid will rarely reach the nucleus if we do not provide to it, the necessary element to trigger a mechanism of nuclear incorporation. Studies were conducted on the use of specific sequences for nuclear import of genetic sequences: DTS sequences (DNA Nuclear Targeting Sequence). This bio-brick is able to play this role. Sequence: 5??? GCATGCTTTG CATACTTCTG CCTGCTGGGG AGCCTGGGGA CTTTCCACAC CCTAACTGAC ACACATTCCA CAGCTGGTTC TTTCCGCCTC AGAAGGTACC T 3??? This sequence, known for having the ability to bind to 10 different transcription factors, provides the transportation of DNA to the nucleus. Added to the therapeutic plasmid, this sequence ensures the entry and the expression of therapeutic plasmid into the nucleus of the target cell. false false _394_ 0 5212 9 It's complicated false It has been sequenced. false David Charoy BBa_K292008_sequence 1 gcatgctttgcatacttctgcctgctggggagcctggggactttccacaccctaactgacacacattccacagctggttctttccgcctcagaaggtacct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z