BBa_K292010 1 BBa_K292010 D protein from the Lambda phage 2009-10-18T11:00:00Z 2015-05-08T01:11:49Z This sequence comes from the Lambda phage genomic DNA. It has been amplified by PCR and introduced into a plasmid which comes from the registry. This part contains the D protein from the Lambda phage. The lambda phage wild type has on its capsid, the D protein, which is in charge of the stabilization of the entire capsid. The D protein is exposed on the entire outer surface of the capsid, so this protein is an ideal candidate to be fused to a cellular internalization protein.<br> The D protein is organized as a trimer. Each monomer is distant of 5,1nm in a trimer. The crystal structure of the protein D, as a trimeric form, shows that the Nter and Cter ends, are exposed at the capsid surface, and are very closed from each other. The Nter and Cter ends are exposed at the mature capsid surface, which allows the choice for the location of the fusion protein (Nter or Cter). However, several studies have showed that the fusion to the Cter end, allows better results.<br> So the D protein can be used to perform a fusion protein. The internalization protein, called polypeptide III, is issued of the adenovirus penton base. It can be used to design a recombinant Lambda phage able to infect eukaryotic cells. false false _394_ 0 5212 9 It's complicated false We have some problem to find the best primers annealing temperature. And we performed a lot of trial to introduce it into a plasmid. false David Charoy BBa_K292010_sequence 1 atgacgagcaaagaaacctttacccattaccagccgcagggcaacagtgacccggctcataccgcaaccgcgcccggcggattgagtgcgaaagcgcctgcaatgaccccgctgatgctggacacctccagccgtaagctggttgcgtgggatggcaccaccgacggtgctgccgttggcattcttgcggttgctgctgaccagaccagcaccacgctgacgttctacaagtccggcacgttccgttatgaggatgtgctctggccggaggctgccagcgacgagacgaaaaaacggaccgcgtttgccggaacggcaatcagcatcgtttaactttacccttcatcactaaaggccgcctgtgcggctttttttacgggattttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z