BBa_K294000 1 BBa_K294000 This is the coding sequence for the heat shock protein hsp15 from E. coli 2009-06-26T11:00:00Z 2015-05-08T01:11:49Z hsp15 is derived from the genome of E. coli K12. We retrieved the [http://BioCyc.org/ECOLI/NEW-IMAGE?type=GENE&object=G7743 sequence] from the Ecocyc database on June 26th 2009. This coding sequence produces a protein that is involved in the heat shock response of E. coli. We are using this part to regulate the activity of a heat shock promoter as part of a bacterial lava lamp. false false _397_ 0 135 84 Not in stock true We chose this heat shock protein because it operates well in multiple bacteria including E. coli and B. subtilis and our project involves both organisms. false Bartholomew Canton annotation2006746 1 hslR range2006746 1 1 402 annotation2006750 1 start codon range2006750 1 1 3 BBa_K294000_sequence 1 atgaaagagaaacctgctgttgaggttcgactggataaatggctatgggctgcccgtttttataaaacccgcgcgctggcccgtgaaatgattgaaggcggtaaggtgcattacaacgggcagcgcagcaagccgagcaaaatcgtcgagctgaatgccacgctcactctgcgccagggaaatgacgaacgcacggtgattgtaaaggcgattactgaacagcgtcgccccgccagcgaggcagccttgctgtatgaagagactgcggaaagtgtagagaaacgcgaaaaaatggcgctggcacgtaaacttaatgccttaaccatgccgcacccggaccgacgcccggacaaaaaagagcgccgcgacctgttacgatttaaacacggcgacagtgaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z